ID: 946297711

View in Genome Browser
Species Human (GRCh38)
Location 2:218799001-218799023
Sequence AAGACTGAAGTCCCTAGAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 288
Summary {0: 1, 1: 1, 2: 3, 3: 32, 4: 251}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946297702_946297711 29 Left 946297702 2:218798949-218798971 CCCTCCGTAATGTAGGTGGGCCT 0: 2
1: 20
2: 178
3: 441
4: 752
Right 946297711 2:218799001-218799023 AAGACTGAAGTCCCTAGAAGGGG 0: 1
1: 1
2: 3
3: 32
4: 251
946297704_946297711 25 Left 946297704 2:218798953-218798975 CCGTAATGTAGGTGGGCCTTGTT 0: 1
1: 0
2: 20
3: 120
4: 411
Right 946297711 2:218799001-218799023 AAGACTGAAGTCCCTAGAAGGGG 0: 1
1: 1
2: 3
3: 32
4: 251
946297707_946297711 9 Left 946297707 2:218798969-218798991 CCTTGTTCAAGCAGTGGAAGGCC 0: 1
1: 0
2: 2
3: 46
4: 289
Right 946297711 2:218799001-218799023 AAGACTGAAGTCCCTAGAAGGGG 0: 1
1: 1
2: 3
3: 32
4: 251
946297703_946297711 28 Left 946297703 2:218798950-218798972 CCTCCGTAATGTAGGTGGGCCTT 0: 2
1: 1
2: 43
3: 223
4: 592
Right 946297711 2:218799001-218799023 AAGACTGAAGTCCCTAGAAGGGG 0: 1
1: 1
2: 3
3: 32
4: 251

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946297711 Original CRISPR AAGACTGAAGTCCCTAGAAG GGG Intronic
900080633 1:854615-854637 AGGACTGAAGTGCATGGAAGAGG - Intergenic
901336629 1:8454844-8454866 AAAACTGAAGACTCAAGAAGGGG + Intronic
901674340 1:10874234-10874256 GAGACTGAGGTCCCAAGACGCGG - Intergenic
903352844 1:22728601-22728623 AAAACTGAAGTCCAGAAAAGGGG - Intronic
903697265 1:25217155-25217177 AGGACTGATGTCCTTATAAGAGG + Intergenic
904806746 1:33137586-33137608 AAGACTGAGATCCCCAGAGGGGG + Intergenic
905630986 1:39518499-39518521 AAGGCTGAGGTATCTAGAAGCGG + Intronic
905666774 1:39767677-39767699 AAGGCTGAGGTATCTAGAAGCGG - Intronic
907747522 1:57228091-57228113 CAGACTGAAGTGCCTATAATAGG + Intronic
908264471 1:62364589-62364611 AAGACTTAATCCCATAGAAGTGG - Intergenic
908445889 1:64199523-64199545 TAGTCAGAAGTCCCAAGAAGAGG + Intergenic
910922959 1:92369429-92369451 ACGCCTGAAGTCCCAACAAGAGG - Intronic
911449280 1:98044684-98044706 AAGACTGAATTCCTGAGAAATGG - Intergenic
912148944 1:106832303-106832325 AGGACTGAGGTCCTCAGAAGAGG - Intergenic
912485254 1:110021950-110021972 AAGACTAAAGTCCCCAGAAATGG - Exonic
912847775 1:113091308-113091330 ATGACTGAAATCCCTGAAAGAGG - Exonic
914928653 1:151909897-151909919 AAGACTGAAGTCCCTGGGGCGGG + Intergenic
914982610 1:152428225-152428247 AAGACTGAGGTTCCCTGAAGAGG - Intergenic
917737185 1:177932134-177932156 ATGACTGATGTCCCTATAAGAGG + Intronic
918329136 1:183440158-183440180 AAGGCTGATATCCTTAGAAGAGG - Intergenic
919072268 1:192771375-192771397 AAGAGTAAAGTCCAAAGAAGTGG + Intergenic
920150816 1:203905963-203905985 AGGACTGGTGTCCCTATAAGAGG - Intergenic
920740745 1:208579106-208579128 ATGACTGATGTCCTTATAAGTGG + Intergenic
922252238 1:223860052-223860074 TAGACTGAAATCCCTTGCAGGGG + Intergenic
922860005 1:228808323-228808345 AAGACTGGGGTCCCCTGAAGAGG + Intergenic
922990107 1:229900503-229900525 AAGCCTTAAGTTGCTAGAAGAGG + Intergenic
923506579 1:234610169-234610191 AAGAATCAAGTCTGTAGAAGTGG - Intergenic
1064596894 10:16954434-16954456 CAGACTGAAATCTCAAGAAGAGG + Exonic
1064725711 10:18277424-18277446 ATCACTGAAGTCCCCACAAGGGG - Intronic
1065372009 10:24996942-24996964 ATGACTGGTGTCCTTAGAAGAGG + Intronic
1065430127 10:25645489-25645511 AAGACTGAGGTACATAGAGGTGG + Intergenic
1065693012 10:28354516-28354538 AAGGCTGAAGACCCTAGGATGGG - Intergenic
1066718404 10:38311869-38311891 GAGAGTGAAGTCCAAAGAAGTGG + Intergenic
1070542018 10:77422702-77422724 ATGACTGGTGTCCCTAGGAGAGG + Intronic
1071242210 10:83719813-83719835 AAGACAGAAGTCCCTGGAACTGG - Intergenic
1075860870 10:125675371-125675393 ACGACTGAACTCCCCAGGAGAGG - Intronic
1076128147 10:127992302-127992324 GAGACGGATGTCCTTAGAAGAGG - Intronic
1076544586 10:131236794-131236816 GAGACATGAGTCCCTAGAAGTGG + Intronic
1078387920 11:10909270-10909292 AAGACTGGGGTCCTTATAAGAGG - Intergenic
1080603555 11:33844537-33844559 AATACTGGTGTGCCTAGAAGGGG + Intergenic
1080765568 11:35293674-35293696 GAGAATGAAGTCCCTAGATAAGG + Intronic
1084109501 11:67004492-67004514 AAGACTGGTGTCCTTATAAGAGG + Intergenic
1084457067 11:69273959-69273981 GAGACTGAAGTCCAGAGAGGTGG - Intergenic
1084733239 11:71088137-71088159 AAGACTGAGGTCCCCTGAGGAGG + Intronic
1086408301 11:86518548-86518570 GAGAGTGAAGTCTGTAGAAGTGG - Intronic
1089198716 11:116710653-116710675 AAGCCTGAAGTCCCCTGAGGAGG + Intergenic
1092559379 12:9594610-9594632 GAGAGTGAAATCCATAGAAGTGG + Exonic
1092929749 12:13304770-13304792 GAGACTTTAGTCCCTAGAAGTGG + Intergenic
1093728069 12:22538884-22538906 CAGACTTAAGTTCATAGAAGAGG - Intronic
1094573414 12:31662113-31662135 AACACTGAAGTCACCAGCAGTGG + Exonic
1095493916 12:42764647-42764669 AAGAGTCAAGTTCCTAGCAGAGG + Intergenic
1096720116 12:53515025-53515047 AAAAGTGAAGTCCCTGGATGTGG + Exonic
1097691252 12:62736381-62736403 AAGCCTGGATTCCCTAGTAGTGG + Intronic
1097968775 12:65610070-65610092 ATGATTGAAGGCCCTGGAAGAGG + Intergenic
1097980285 12:65730972-65730994 CATACTGAAGGCTCTAGAAGAGG - Intergenic
1098146603 12:67503998-67504020 CAGTTTGATGTCCCTAGAAGGGG + Intergenic
1098511785 12:71323854-71323876 AAGACTGAAATCTGAAGAAGTGG + Intronic
1100522660 12:95390222-95390244 AAGACAGAACACCCTAAAAGGGG - Intergenic
1101500504 12:105299784-105299806 AAGACAGAAATTCCTAGAAGCGG - Intronic
1101745928 12:107541596-107541618 AAGACTGAAGTTCTCCGAAGAGG - Intronic
1102117933 12:110417657-110417679 AAGAGTGAAGTCTGAAGAAGTGG - Intergenic
1102191875 12:110994909-110994931 AGGACTGGTGTCCTTAGAAGAGG - Intergenic
1103437475 12:120937876-120937898 ATTTCTGAATTCCCTAGAAGTGG - Intergenic
1104281966 12:127386657-127386679 AAGAATGAAGTACAAAGAAGCGG + Intergenic
1108919947 13:55660933-55660955 AAGACTGAGGTCCCTTGAAGGGG + Intergenic
1109976221 13:69836065-69836087 AAGCCTGAAGTCCCAGAAAGAGG + Intronic
1110725922 13:78823519-78823541 AAGACTGGTGTCCTTATAAGAGG - Intergenic
1110794488 13:79620747-79620769 AAGACTAAACTCACTAGAAAGGG - Intergenic
1112530624 13:100198935-100198957 AAGCCTAAAGTCCCTGGAAGAGG + Intronic
1115534984 14:34364384-34364406 AAGACTCAGGTCCCTTGAAGAGG - Intronic
1116212263 14:41963400-41963422 AAGACTCATGTCCCTATAAAAGG - Intergenic
1118160909 14:63289292-63289314 AAGACTGCACACCCTAGAGGGGG + Intronic
1119740589 14:77011587-77011609 GAGGCTGAAGACCCTGGAAGGGG - Intergenic
1119859863 14:77928304-77928326 AAGACTGGAGTTCACAGAAGAGG + Intronic
1120622553 14:86782356-86782378 AAGACTGAGGTTCCCACAAGAGG - Intergenic
1121171163 14:91855523-91855545 ATGACTGATGTCCTTACAAGAGG - Intronic
1123413933 15:20081592-20081614 GAGAATGGAGTCCCTAGAAGTGG + Intergenic
1123523275 15:21088703-21088725 GAGAATGGAGTCCCTAGAAGTGG + Intergenic
1124659298 15:31532589-31532611 AAGTCTGGAGTCCGTAGAAGAGG + Intronic
1125296806 15:38212093-38212115 AAGACTGATCTCCAAAGAAGAGG - Intergenic
1125768261 15:42149276-42149298 AGGACTGGGGTCCTTAGAAGAGG + Intronic
1127033028 15:54884965-54884987 AATACTGAAATCCCTTTAAGTGG + Intergenic
1127638948 15:60897167-60897189 AAGAGAGAAAGCCCTAGAAGGGG + Intronic
1128714211 15:69895296-69895318 AAGACTGAAGTCCAGGAAAGAGG - Intergenic
1130173775 15:81546457-81546479 GAGACTGAAGTGCCTGGAAGAGG - Intergenic
1130305832 15:82711561-82711583 AAGACTGAAGTCCCAGGCTGGGG - Intergenic
1132844427 16:1993276-1993298 AGGACTGAGGTCCTGAGAAGGGG + Exonic
1139081650 16:63529100-63529122 AAGACTGCAGTCAGTGGAAGTGG + Intergenic
1141021722 16:80502899-80502921 ATGAGTGAAGTCCCTAGAGATGG - Intergenic
1141504392 16:84465027-84465049 AAGGCTGAACTCCCTTGAGGAGG - Intergenic
1143432488 17:6897283-6897305 GAGTCTGGAGTTCCTAGAAGAGG + Intronic
1148162665 17:45460007-45460029 ATGACTGATGTCCTTATAAGAGG + Intronic
1149047781 17:52267558-52267580 AACACTGAAGACCCAGGAAGAGG - Intergenic
1150393893 17:64806672-64806694 ATGACTGATGTCCTTATAAGAGG + Intergenic
1152297321 17:79475609-79475631 ATGACTGGTGTCCTTAGAAGAGG + Intronic
1152300636 17:79493526-79493548 AAGACCGAAGACCCTGGGAGTGG - Intronic
1153706817 18:7754363-7754385 TAGATTCAAGTACCTAGAAGAGG - Intronic
1155302037 18:24439075-24439097 AAGACTGACCTCCCCAGAAGAGG - Intronic
1155612388 18:27681310-27681332 AAGACTAAAGTCACTAGCACTGG - Intergenic
1155921016 18:31602894-31602916 ATGACTGGGGTCCTTAGAAGAGG - Intergenic
1157479861 18:48046806-48046828 GAGACAGAAGTCCAGAGAAGTGG - Intronic
1158912381 18:62077984-62078006 ATGACTGATGTCCTTATAAGAGG - Intronic
1159342752 18:67158227-67158249 AAGACTGAAGATGCAAGAAGTGG - Intergenic
1162911680 19:13851176-13851198 AAGACTGGAACCCCTAGAAGTGG + Intergenic
1165641092 19:37387491-37387513 AGGTCTGAAGTACCTAGTAGAGG - Intronic
1165667604 19:37647167-37647189 AGAAATGAAGTTCCTAGAAGTGG - Intronic
1166591163 19:44000746-44000768 AAGACTCAAGTAACTAAAAGTGG + Intergenic
1167082482 19:47286458-47286480 GAGACTGAGGTCCCTTAAAGGGG + Intergenic
926116770 2:10218309-10218331 AAGTCTGGAGTCCTTAGAAGAGG - Intergenic
926578266 2:14606941-14606963 AAGAAGGAAGCCCCTTGAAGAGG + Intergenic
929029467 2:37637023-37637045 AAGACTAAAGTCCTGGGAAGTGG + Intergenic
929483702 2:42336743-42336765 GAGACTGAAGTCCGTAGAAGAGG - Intronic
929672256 2:43885838-43885860 AAGACTGAAGTCTTTTGAAATGG + Intergenic
930466159 2:51752567-51752589 AAGACTCAAGTACAAAGAAGAGG - Intergenic
930770298 2:55124210-55124232 AAGACTGAATTCCTGAGGAGGGG + Intergenic
931501134 2:62868389-62868411 AAAACTGAAGATTCTAGAAGAGG + Intronic
933443281 2:82342549-82342571 ATGACTGTAGTCCCAAGAATAGG - Intergenic
935800900 2:106694854-106694876 AAAAGTGAAGTTCCTAGAACCGG + Intergenic
936399146 2:112152665-112152687 AAGACTGAGGTCCCCTGAGGAGG + Intronic
937306463 2:120874511-120874533 AAGACGGATGTGCCTGGAAGCGG + Intronic
937774256 2:125757082-125757104 AAGACTGAATTCCATTTAAGAGG + Intergenic
941739125 2:169014526-169014548 TATACTGAAATCTCTAGAAGAGG - Intronic
941881953 2:170489748-170489770 AAGATTGAAGTCCCGTGACGAGG - Intronic
944849683 2:203705741-203705763 AAGAATAAAGTCTCTAGCAGAGG - Intergenic
945142642 2:206703267-206703289 GAGACTGGAGTGCTTAGAAGCGG - Intronic
946183466 2:217963134-217963156 AAGAATTAAGTCCTTGGAAGGGG + Intronic
946297711 2:218799001-218799023 AAGACTGAAGTCCCTAGAAGGGG + Intronic
946724715 2:222650979-222651001 CAGACTTTAGTCCCTGGAAGTGG + Intronic
947042166 2:225935400-225935422 AAGACTGAACTCTCAAGAATGGG - Intergenic
948069939 2:235112595-235112617 AAGACAGAAGTTCCCTGAAGAGG + Intergenic
948497332 2:238360263-238360285 AGGACTGTTGTACCTAGAAGTGG + Intronic
1169457900 20:5768416-5768438 AAGACAGAAGAGCCCAGAAGGGG - Intronic
1170335437 20:15265465-15265487 AAGACTGAATTGCCAAGAAAGGG - Intronic
1172588039 20:36098568-36098590 ATGACTGGTGTCCTTAGAAGAGG - Intronic
1172606473 20:36217500-36217522 ATGACTGATGTCCCTAGTGGTGG + Intronic
1174332281 20:49829923-49829945 AAGAGCAAAGTCCCCAGAAGCGG + Intronic
1174881113 20:54280468-54280490 AAGACTGAAGTCCATTGAACAGG + Intergenic
1175527583 20:59646144-59646166 AAGGCTCAAGTCCCCTGAAGTGG + Intronic
1175737669 20:61398578-61398600 AAGACTCGGCTCCCTAGAAGAGG - Intronic
1176287918 21:5028620-5028642 AAGACTGAAGCCCCCAGACACGG + Intronic
1176846323 21:13879307-13879329 AAGACTGGAGTCCCTAAACATGG - Intergenic
1176849060 21:13898849-13898871 AAGACTGGAGTCCCTAAACATGG - Intergenic
1177184960 21:17783223-17783245 AAGAGTGAGGTCCCCTGAAGAGG + Intergenic
1177943500 21:27440277-27440299 AAGACCCAAGTCCCTAAATGAGG + Intergenic
1178223559 21:30688606-30688628 AAGACTGAGGTCCCCCAAAGAGG + Intergenic
1178322591 21:31616738-31616760 AAGACTGATGTCCCCTGAAGAGG + Intergenic
1178522480 21:33298045-33298067 AAGCCTGAGGTCCCTTGAGGAGG - Intergenic
1179531884 21:42025166-42025188 AAGACTGAGGTCCCCTGAACAGG - Intergenic
1179869263 21:44234855-44234877 AAGACTGAAGCCCCCAGACACGG - Intronic
1183047809 22:35234174-35234196 AAGACTGCTGTCCTTAGAAAAGG - Intergenic
1183865577 22:40701596-40701618 AAGAGTGAAGTCTGAAGAAGTGG - Intergenic
1184301737 22:43564861-43564883 AAGACAGAACTTCATAGAAGGGG + Intronic
1185325550 22:50224160-50224182 AAGGCTGAAGTCCCTGGAGGAGG - Exonic
949526569 3:4910497-4910519 AGCAGTGAAGTCCCTGGAAGAGG + Intergenic
951753310 3:26061164-26061186 AAGATTGAAGACTCAAGAAGTGG + Intergenic
954403781 3:50333812-50333834 AAGAATCCAGTCCCTAGATGAGG - Intronic
954493648 3:50931263-50931285 GAAAGTGAAGTTCCTAGAAGAGG - Intronic
955716796 3:61837940-61837962 AAGGCTGATGTCCCTGTAAGAGG - Intronic
955859140 3:63308954-63308976 GAAACTGAAGTCTATAGAAGGGG - Intronic
957602200 3:82352161-82352183 AAAACTGAAGTCCAGAAAAGTGG + Intergenic
958027051 3:88059987-88060009 ATGACAGGAGACCCTAGAAGAGG - Intronic
958179781 3:90045488-90045510 AAGACCGAAGTCCTTCAAAGAGG - Intergenic
960358682 3:116684197-116684219 ATGACTGATGTCCTTATAAGAGG - Intronic
962076381 3:132086666-132086688 AAGATTGGAATCCATAGAAGCGG - Intronic
964899470 3:161640747-161640769 AGAATTGAAGTCCTTAGAAGAGG - Intergenic
965622847 3:170658044-170658066 ATGACTGATGTCCTTATAAGAGG - Intronic
965643770 3:170858727-170858749 AAAACTGAAGTCACTATAAGAGG - Intronic
965715322 3:171596436-171596458 AAATCTGAAGTGCCTAGAAGAGG + Intergenic
965784200 3:172318982-172319004 GAGACTGAGGTCCCTAAAAGAGG - Intronic
966223119 3:177570073-177570095 ATGACTGATGTCCTTATAAGAGG - Intergenic
966369735 3:179236877-179236899 GATACTGAAGTACCCAGAAGTGG - Exonic
968979643 4:3839860-3839882 AACACTGAATTCCTTAGAAGGGG + Intergenic
968984376 4:3867182-3867204 ATGACTGGTGTCCTTAGAAGGGG - Intergenic
971369337 4:26003282-26003304 AAGACAGCAGTCCCTGGGAGGGG - Intergenic
973973234 4:56236153-56236175 ATGACTGATGTCCTTAAAAGGGG + Intronic
975721158 4:77249884-77249906 AACACTGGAGTCCCATGAAGAGG - Intronic
976962213 4:90991597-90991619 ATGACTGAGATCCTTAGAAGAGG - Intronic
979204466 4:118020951-118020973 AAGATTGAAGAGCCTTGAAGAGG - Intergenic
979217643 4:118184404-118184426 AAGACTGACCTCCCCAGAAGAGG + Intronic
982028334 4:151274951-151274973 ATGAGTGATGTCCTTAGAAGAGG - Intronic
982379054 4:154728491-154728513 AAGATTGAATTCACCAGAAGAGG - Intronic
982595426 4:157377504-157377526 GAGACTGTAGTATCTAGAAGTGG + Intergenic
982952361 4:161715935-161715957 AAGAATGCAGTCCCTGGAATAGG - Intronic
983141867 4:164159861-164159883 AAGAATGAGGTCCAGAGAAGAGG - Intronic
983370613 4:166852737-166852759 AAGAATGAAGTTCCTAGATTTGG - Intronic
987141873 5:14954764-14954786 AAGTCTGACGTCCCTAGAGCAGG + Intergenic
988778061 5:34495101-34495123 ATGACTGATGTCCTTATAAGAGG + Intergenic
989125432 5:38048180-38048202 AAAACTGAAGTCACTCGAGGAGG + Intergenic
990835612 5:60015810-60015832 CAGACTGAAGACCCAAGGAGTGG - Intronic
991085054 5:62641051-62641073 ATGACTGATGTCCTTATAAGAGG - Intergenic
991092219 5:62704663-62704685 AAGGCTGAGGTCTCTATAAGAGG - Intergenic
992161533 5:74008690-74008712 AAGACTAGTGTCCTTAGAAGAGG - Intergenic
992224612 5:74607928-74607950 AAGAGTGAAGTCCGAAGAAATGG + Intergenic
992572867 5:78077671-78077693 AAGAATGACGCTCCTAGAAGAGG - Intronic
993484849 5:88470998-88471020 AAGACTGAGGATCCCAGAAGAGG - Intergenic
993932455 5:93956421-93956443 AAGACTGAAATTCCTAAAATTGG - Intronic
995319622 5:110818720-110818742 CAAACATAAGTCCCTAGAAGAGG - Intergenic
998207744 5:140171102-140171124 ACCACTGAAGTTCCTTGAAGTGG - Intergenic
998252353 5:140561689-140561711 AAAAGCGAAGTCCCTAGCAGGGG + Exonic
998494772 5:142578572-142578594 AAGACTGACCTCCCTTGAGGAGG - Intergenic
998951976 5:147401684-147401706 AAGACTACATTTCCTAGAAGGGG + Exonic
999943392 5:156569092-156569114 TAGACTGTGGTACCTAGAAGAGG - Intronic
1000173048 5:158722848-158722870 AAGACTGAAGCCCTTAGGAATGG - Intronic
1000258468 5:159563153-159563175 AAGACTGAAGTCTCTGGAGTAGG + Intergenic
1001873915 5:175182781-175182803 AGAACTGAGGTCCCCAGAAGTGG - Intergenic
1004757285 6:18625483-18625505 AAGACTGAGGTCCCCAAAAGAGG - Intergenic
1004971484 6:20915448-20915470 AAGACTAAAGTTCAGAGAAGAGG - Intronic
1007586527 6:42993721-42993743 ATGACTGGTGTCCTTAGAAGAGG - Intronic
1011433459 6:87312988-87313010 AAGACTGAAATCTCCAGGAGAGG - Intronic
1013229236 6:108146529-108146551 AAGACTGAGGTCCCTAGAAGAGG + Intronic
1014604696 6:123458445-123458467 AAGACTGAAGTCCCCCAAGGAGG + Intronic
1014995241 6:128134919-128134941 AAGACAAAGGTCCCTAGTAGAGG + Intronic
1016439172 6:144065741-144065763 AAGAATGAAGTGCCTTGAACAGG - Intergenic
1016583282 6:145653731-145653753 AAGACTGACTTCCCCAGAAGAGG - Intronic
1017183686 6:151578489-151578511 ATGACTGAGGTCCTTATAAGAGG - Intronic
1017233730 6:152098655-152098677 AGTGCTGAAATCCCTAGAAGGGG - Intronic
1019434203 7:1013411-1013433 GAAACTCAAGTCCCTAGAAGGGG - Intronic
1021435953 7:20615753-20615775 AAGACTGAAGTCTTCTGAAGAGG - Exonic
1022720628 7:32939120-32939142 AAGACTGAAGACCCCAAAAAAGG - Intergenic
1023895460 7:44429336-44429358 ATGACTGATGTCCTTAAAAGGGG + Intronic
1025217460 7:57070728-57070750 AAGCCTGTAGTGCATAGAAGTGG - Intergenic
1025653890 7:63499737-63499759 AAGCCTGTAGTGCATAGAAGTGG + Intergenic
1027960127 7:84935197-84935219 AAGACTGATTTTCTTAGAAGTGG + Intergenic
1027990699 7:85357029-85357051 AAGACTGAATTGCCTTGCAGTGG - Intergenic
1028435696 7:90800969-90800991 ATGACTGATGTCCCTATAAGAGG - Intronic
1029185744 7:98737217-98737239 CAGACTGTCGTCCCTAGCAGGGG - Intergenic
1029992387 7:104974118-104974140 AAGCCTGAAATCCCAAGAGGAGG - Intergenic
1031206442 7:118764163-118764185 AATGCTGTAGTCCTTAGAAGAGG - Intergenic
1031328956 7:120438961-120438983 AAGATTTAAGTGCCTAGAACAGG - Intronic
1032367499 7:131314284-131314306 AAGACAGAAGACCCCAGAAAGGG + Intronic
1033291375 7:140086304-140086326 AAGTCTTAAGACACTAGAAGGGG + Exonic
1033777179 7:144625425-144625447 GAGAATGAACTCACTAGAAGTGG + Intronic
1035250037 7:157591081-157591103 ATGACTGACATCCTTAGAAGAGG + Intronic
1035485271 7:159218613-159218635 AAGACTGAGATGCCCAGAAGGGG + Intergenic
1035524634 8:302864-302886 AGGACTGAAGTGCATGGAAGAGG + Intergenic
1035848319 8:2888902-2888924 AATATTTAAGTCCCCAGAAGTGG - Intergenic
1037283670 8:17272304-17272326 AGGGCTGAAGTACCTGGAAGTGG - Intronic
1037343337 8:17871030-17871052 AAGACTGGAGTCCCTTTAAGAGG + Intronic
1038659091 8:29481306-29481328 AAGACTAAGGTCCATAGAAAAGG - Intergenic
1039684201 8:39779346-39779368 AGGACTGCTGTCCATAGAAGAGG - Intronic
1039714847 8:40096803-40096825 AAGAATGAAATCCATAGAAAGGG - Intergenic
1040948422 8:52910241-52910263 GAGAGTGAAGTCCAAAGAAGTGG - Intergenic
1042316077 8:67427369-67427391 CAGAGTGAAGTCCAAAGAAGTGG - Intronic
1042469899 8:69174579-69174601 AACACTGAAGAGCCCAGAAGAGG - Intergenic
1042747333 8:72121684-72121706 AAGACTGCAGGCCTTAGAAATGG - Intergenic
1043404318 8:79915302-79915324 ATGACTGGTGTCCTTAGAAGAGG - Intergenic
1044552766 8:93530271-93530293 AAACCTGAAGTTACTAGAAGAGG + Intergenic
1044820335 8:96152057-96152079 AGGACTGAAGTCCAGAGAACTGG - Intronic
1044826369 8:96201690-96201712 AACACAGAACTCACTAGAAGGGG - Intergenic
1047203538 8:122785546-122785568 AAGACAGAAGTCCCTGAGAGGGG - Intronic
1047284059 8:123471238-123471260 ATGACTGATGTCCTTATAAGAGG - Intergenic
1047343747 8:124007352-124007374 AAGACTAAAGTCCATGGAATGGG - Intronic
1047771788 8:128035766-128035788 GAGACTGAATACCCTAGAGGAGG + Intergenic
1049838205 8:144754001-144754023 GGGAGTGAAGTCCCTAGAACTGG + Intronic
1049939961 9:535976-535998 AAGACTTTAGTACCTGGAAGTGG - Intronic
1050395922 9:5195622-5195644 AAGACTGAAATGCCCAGAACAGG - Intergenic
1051345077 9:16144093-16144115 AACACTGAGGTCCCCTGAAGAGG - Intergenic
1052080018 9:24193058-24193080 GAAACTGATGTGCCTAGAAGGGG + Intergenic
1052396979 9:27950191-27950213 TAACCTGAAGTCTCTAGAAGTGG - Exonic
1052549099 9:29924637-29924659 AAGACTTTAGTCATTAGAAGAGG - Intergenic
1055019363 9:71652707-71652729 AAGATGGAGGTCCCTGGAAGAGG + Intergenic
1057351426 9:94301741-94301763 ATGACTGGTGTCCCTAGAAGAGG - Intergenic
1058203631 9:102074044-102074066 GAGTCTGAAGTTCCAAGAAGTGG - Intergenic
1059344738 9:113620516-113620538 AGGACCGAAGTCCAGAGAAGTGG + Intergenic
1059352037 9:113672412-113672434 AAGACTGAGGTCCCCAGGAGAGG + Intergenic
1060962881 9:127693571-127693593 GAGACAGAAGTCCCTACAAAGGG - Intronic
1185870064 X:3657335-3657357 AGGACTGGAGTCCTAAGAAGAGG + Intronic
1187337663 X:18394968-18394990 AAGCCTGAAGGACCAAGAAGAGG - Intergenic
1188082971 X:25867165-25867187 ATGACTCATGTCCCTAAAAGAGG + Intergenic
1188103982 X:26125735-26125757 AAGACTGAAGGCCTGAGAATAGG - Intergenic
1188312319 X:28632300-28632322 AGGACTGATGTCCTTATAAGAGG - Intronic
1188581653 X:31721422-31721444 AAGACTGAAGTCCCCAGAAAAGG + Intronic
1190045431 X:47108164-47108186 AAGACTGATCTCCCCAGAAGAGG + Intergenic
1190536767 X:51436528-51436550 ACAACTAAAGTCCCTAGTAGTGG - Intergenic
1190633780 X:52414525-52414547 AAGACTGAATTCCCAAGGAGGGG + Intergenic
1191146355 X:57169684-57169706 AAGATTGAGGTTCCCAGAAGAGG + Intergenic
1192848322 X:74927645-74927667 ATGACTGAGGTCCTTATAAGAGG + Intergenic
1193901653 X:87186434-87186456 AAGACTGACTTCCCTCAAAGAGG - Intergenic
1194180660 X:90707404-90707426 ATGACTGAGGTCCTTATAAGAGG + Intergenic
1194318725 X:92415269-92415291 AACACTTAACTTCCTAGAAGAGG + Intronic
1194871004 X:99131003-99131025 GTGACTGAAGTACCTAGCAGAGG + Intergenic
1196044723 X:111245532-111245554 AAGTCTCAAGTCCCCAGATGGGG + Exonic
1197187268 X:123601604-123601626 AAGACTTGAGTCCCCAGAAAAGG + Intronic
1197382052 X:125756913-125756935 AAGACTGAACTTCCTTAAAGTGG + Intergenic
1197829137 X:130622972-130622994 AAGACTGAAGTCCCCTGAGGAGG - Intergenic
1198315806 X:135464913-135464935 AAGAGTGCAGTCCCTGGAGGAGG + Intergenic
1198672015 X:139091256-139091278 AAAGCTGAAGTCCTGAGAAGGGG + Intronic
1198729993 X:139718646-139718668 AAAACTGAGGTCCAAAGAAGGGG - Intergenic