ID: 946299275

View in Genome Browser
Species Human (GRCh38)
Location 2:218812704-218812726
Sequence TTCTGGAAGCGATACCTGGA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 106}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946299265_946299275 8 Left 946299265 2:218812673-218812695 CCTCCCCAAGTGGACTCGCCCCG 0: 1
1: 0
2: 0
3: 1
4: 56
Right 946299275 2:218812704-218812726 TTCTGGAAGCGATACCTGGATGG 0: 1
1: 0
2: 0
3: 11
4: 106
946299264_946299275 12 Left 946299264 2:218812669-218812691 CCTTCCTCCCCAAGTGGACTCGC 0: 1
1: 0
2: 0
3: 13
4: 130
Right 946299275 2:218812704-218812726 TTCTGGAAGCGATACCTGGATGG 0: 1
1: 0
2: 0
3: 11
4: 106
946299270_946299275 -10 Left 946299270 2:218812691-218812713 CCCCGTGCTGCCTTTCTGGAAGC 0: 1
1: 0
2: 0
3: 10
4: 178
Right 946299275 2:218812704-218812726 TTCTGGAAGCGATACCTGGATGG 0: 1
1: 0
2: 0
3: 11
4: 106
946299268_946299275 3 Left 946299268 2:218812678-218812700 CCAAGTGGACTCGCCCCGTGCTG 0: 1
1: 0
2: 0
3: 2
4: 48
Right 946299275 2:218812704-218812726 TTCTGGAAGCGATACCTGGATGG 0: 1
1: 0
2: 0
3: 11
4: 106
946299267_946299275 4 Left 946299267 2:218812677-218812699 CCCAAGTGGACTCGCCCCGTGCT 0: 1
1: 0
2: 0
3: 3
4: 30
Right 946299275 2:218812704-218812726 TTCTGGAAGCGATACCTGGATGG 0: 1
1: 0
2: 0
3: 11
4: 106
946299266_946299275 5 Left 946299266 2:218812676-218812698 CCCCAAGTGGACTCGCCCCGTGC 0: 1
1: 0
2: 0
3: 2
4: 32
Right 946299275 2:218812704-218812726 TTCTGGAAGCGATACCTGGATGG 0: 1
1: 0
2: 0
3: 11
4: 106
946299263_946299275 15 Left 946299263 2:218812666-218812688 CCACCTTCCTCCCCAAGTGGACT 0: 1
1: 0
2: 3
3: 30
4: 329
Right 946299275 2:218812704-218812726 TTCTGGAAGCGATACCTGGATGG 0: 1
1: 0
2: 0
3: 11
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946299275 Original CRISPR TTCTGGAAGCGATACCTGGA TGG Exonic
900207183 1:1436552-1436574 CTCTGAAAGCCATGCCTGGAGGG + Intronic
902901299 1:19518130-19518152 TTCTGGTACCTCTACCTGGAAGG + Intergenic
904652019 1:32013286-32013308 TTGGGGAAGGGAAACCTGGAGGG - Intergenic
915958702 1:160245597-160245619 TTCAGGAAGGGACACCTGGAAGG + Intronic
917046251 1:170863931-170863953 TTCTGGAAGAGCCACCTGTAAGG + Intergenic
924192069 1:241564189-241564211 CTCTGTAAGCTATACATGGAAGG + Intronic
1063513782 10:6673435-6673457 TTCTGGAAACTATAATTGGATGG + Intergenic
1069785100 10:70982816-70982838 TTCTAGGAGCAAGACCTGGAAGG - Intergenic
1075416501 10:122268275-122268297 CTCTAGAAGTGATACCTGGAGGG + Intergenic
1077616115 11:3675300-3675322 TTCTGGAAGGGGTAGATGGAGGG + Exonic
1078188974 11:9075908-9075930 TTCTGGAAGGGACACATGGAAGG + Intronic
1082991764 11:59212719-59212741 TCCTGGAAGTCCTACCTGGAGGG - Exonic
1087365526 11:97213994-97214016 TTCTACATGAGATACCTGGAAGG + Intergenic
1090737804 11:129626174-129626196 TTCTGAAGGAGATCCCTGGAGGG + Intergenic
1092214855 12:6673937-6673959 TTTTGGCAGCGATTCCTAGAGGG + Intronic
1096467171 12:51853025-51853047 TCCTGGAGGAGAGACCTGGAAGG - Intergenic
1098337722 12:69420869-69420891 TTCTGGATGCTGTACATGGATGG + Intergenic
1098756814 12:74374202-74374224 TTCTGGAAGTGATAGCTTGTGGG + Intergenic
1100112086 12:91257904-91257926 TTTTTGGAGCAATACCTGGAAGG + Intergenic
1101133073 12:101709434-101709456 TTTGGAAAGGGATACCTGGAAGG + Intronic
1106620805 13:31368689-31368711 TTGTAGAAGTGCTACCTGGATGG - Intergenic
1114084336 14:19228546-19228568 TTCTAAAAGCCATACCTGAAGGG + Intergenic
1114827945 14:26104420-26104442 TCCTAGAAGAGATAGCTGGATGG - Intergenic
1116858989 14:49978816-49978838 TGCTGGTAGAGATGCCTGGACGG + Intergenic
1121033603 14:90680342-90680364 TTCTAGAGGGTATACCTGGATGG - Intronic
1202895946 14_GL000194v1_random:10408-10430 TTCTAAAAGCCATACCTGAAGGG + Intergenic
1127293409 15:57590279-57590301 TTTTGGAAGGGATAGGTGGATGG + Intergenic
1128744402 15:70103397-70103419 TTCTGGAAGGGCTTCCTGGAAGG + Intergenic
1128807227 15:70540077-70540099 GCCTGGGAGCGAGACCTGGAAGG - Intergenic
1132356538 15:101174921-101174943 TTCTGGAAACGGAGCCTGGAAGG + Intergenic
1133170356 16:3979164-3979186 TGCGGGAAGCGACACCAGGATGG + Exonic
1135669289 16:24361591-24361613 CTCCGGAATCGATACCTGTAGGG - Exonic
1136265071 16:29111464-29111486 TTCGGGAAGGCATTCCTGGAAGG - Intergenic
1139284134 16:65795779-65795801 TTCTGGAAGCTTGACCTGCATGG + Intergenic
1140971779 16:80020396-80020418 TTCTGGAAGTGTTTCCTGCAGGG - Intergenic
1141763889 16:86046217-86046239 TTCTGAAGGCGAAACCTGCAGGG - Intergenic
1142053870 16:87979439-87979461 TTCGGGAAGCCGTTCCTGGAAGG - Intronic
1144312512 17:14025801-14025823 TTCTAAAAGCCATACCTGAAAGG - Intergenic
1144332240 17:14235524-14235546 TTCTAAAAGCCATACCTGAAAGG + Intergenic
1145161965 17:20581039-20581061 TTCTAAAAGCCATACCTGAAAGG - Intergenic
1149314207 17:55423059-55423081 GTATGGACACGATACCTGGAAGG - Intergenic
1203167534 17_GL000205v2_random:111661-111683 TTCTGTAAGGGATTGCTGGAAGG + Intergenic
1153114469 18:1638607-1638629 TTCTGGAATTCAGACCTGGATGG + Intergenic
1155878961 18:31119972-31119994 TTCTGGAATGGATACATGGTTGG + Intergenic
1156887841 18:42156292-42156314 CTCTGAAAGGGATATCTGGATGG - Intergenic
1158442637 18:57490617-57490639 TTCTAGAATAGCTACCTGGAAGG - Exonic
1164523623 19:28997698-28997720 TTCAGGAAGCAAGACCTGGATGG + Intergenic
929130756 2:38567587-38567609 TTGTGGAAGCTATAGCTTGAAGG + Intronic
929289271 2:40170666-40170688 TTCTGCAAGCGGTACCTTGAAGG - Intronic
930961048 2:57262156-57262178 TTATGGAAGCAATAACTGTAAGG - Intergenic
933897488 2:86824818-86824840 TTCTGGAAGCGATTCAGGGAAGG - Intronic
937097182 2:119242966-119242988 TTCTGGGAGCGTTTCCTGGGTGG - Intronic
938495312 2:131794808-131794830 TTCTAAAAGCCATACCTGAAGGG + Intergenic
938660695 2:133484003-133484025 TTTTGGAAGTGAAGCCTGGATGG + Intronic
939668283 2:144977627-144977649 TTCTGAAGGCGCTACCGGGAAGG - Intergenic
939833419 2:147099826-147099848 TTCTGGAACAGTTACCTAGAAGG - Intergenic
941502717 2:166299892-166299914 TTCTGGCTGCAATAACTGGATGG - Intronic
943660206 2:190551986-190552008 TCCTGGAAGGGAATCCTGGAAGG + Intergenic
944341755 2:198609735-198609757 TTTTGGAAGGGATCCCTGAAAGG - Intergenic
944623846 2:201548941-201548963 TCCTGGAAGAGATACTTGGCTGG - Intronic
946299275 2:218812704-218812726 TTCTGGAAGCGATACCTGGATGG + Exonic
946669083 2:222083120-222083142 TTCTGGAAGCCATACATGAAAGG + Intergenic
947154166 2:227144819-227144841 CTCTGAAAGTGAGACCTGGAGGG + Intronic
1169358007 20:4924192-4924214 TCCTGGAAGAGACTCCTGGAAGG - Intronic
1171483944 20:25474183-25474205 TCCTGGAAGCCAGCCCTGGATGG - Intronic
1176404224 21:6347474-6347496 TTCTGTAAGGGATTGCTGGAAGG - Intergenic
1176432933 21:6641630-6641652 TTCTGTAAGGGATTGCTGGAAGG + Intergenic
1176615635 21:9026460-9026482 TTCTAAAAGCCATACCTGAAGGG + Intergenic
1176709539 21:10137344-10137366 TTCTAAAAGCCATACCTGAAGGG - Intergenic
1176920003 21:14677234-14677256 TTCTGAAAGAGATAGCAGGAGGG - Intergenic
1177726841 21:24980444-24980466 TTCTGGAAGAGATACCAGATAGG - Intergenic
1179203522 21:39250004-39250026 TTCTGGAAGAGGAAGCTGGAAGG + Intronic
1180293636 22:10864657-10864679 TTCTAAAAGCCATACCTGAAGGG - Intergenic
1180496441 22:15894072-15894094 TTCTAAAAGCCATACCTGAAGGG - Intergenic
1183179013 22:36245995-36246017 ATCTGAAAGTGAGACCTGGAAGG + Intergenic
949475654 3:4442541-4442563 TTCTGGAAGGGAACCCTGGCAGG - Intronic
952201011 3:31127596-31127618 TTCTGGAAGAAATAGCTGCAAGG + Intergenic
952965213 3:38616878-38616900 TTATGGAAACCAAACCTGGAGGG - Intronic
959610953 3:108294398-108294420 TTCAGGAAGGGGTACCTGAAAGG - Intergenic
959989302 3:112612933-112612955 TTCTGGTAGCTCTTCCTGGATGG + Intronic
965096983 3:164242435-164242457 ATCTGGAAGAGATACTTGCAGGG - Intergenic
970898554 4:21131912-21131934 TTTGAGAAGCCATACCTGGAAGG - Intronic
971364733 4:25968631-25968653 TTGGGGAAGTGATACCAGGAAGG - Intergenic
974246734 4:59329832-59329854 TTCTGGAAGTTATACCTAGTAGG + Intergenic
977134598 4:93287812-93287834 TTCTGGAGGCAATACCTAGATGG + Intronic
979733539 4:124053926-124053948 TTATGGTAGAGATGCCTGGAGGG + Intergenic
980158609 4:129134406-129134428 TTCTAAAAGCCATACCTGAAAGG - Intergenic
983227110 4:165095550-165095572 TTCTGGAAGGAATTCCTGGCAGG - Intronic
984870911 4:184324197-184324219 TTCTGGAAGCTTTTCCTGGTGGG - Intergenic
991421955 5:66451280-66451302 TTGCGGAGGCCATACCTGGAAGG + Intergenic
991645826 5:68799549-68799571 TTCAGGAAGGGGTACCTGGATGG - Intergenic
999655557 5:153807208-153807230 TTGTGGAAGGGATGCCTGTAGGG - Intronic
1002114148 5:176945124-176945146 TTCTGGAAGCGGATCCTGCAAGG + Intronic
1005201194 6:23346761-23346783 TTCTGGAAGTGAGAACTGAAAGG + Intergenic
1010069321 6:71724967-71724989 TTCTGGAATGTATAACTGGAGGG + Intergenic
1011197914 6:84801276-84801298 TACTGGATGGGACACCTGGATGG - Intergenic
1016434037 6:144017364-144017386 TTGGGGAAGTGATACCTAGATGG - Intronic
1021898646 7:25261552-25261574 TTCTGGAATCGAAACCTTGGAGG + Intergenic
1024813178 7:53237091-53237113 GTCTGAAAGAGATACCTGTAAGG - Intergenic
1029642846 7:101832104-101832126 TTCTGGAAGCCCCACATGGAAGG + Intronic
1037507910 8:19550920-19550942 TTCTGGAAAACATACCTGCAAGG + Intronic
1040372666 8:46792747-46792769 TTCTGGCAGACATTCCTGGAAGG + Intergenic
1040579552 8:48686318-48686340 GTCTGGATGTGATACCTGAAAGG - Intergenic
1041977985 8:63821199-63821221 TTCTGAAAACGATCTCTGGATGG + Intergenic
1046066856 8:109207616-109207638 TTCTGGAAGCTTTACTTGGTAGG + Intergenic
1051321380 9:15908892-15908914 TGCTGGAAGCGGGACCTGGTGGG - Intronic
1051592012 9:18785794-18785816 TTCTAGAAACAATACCTGGAAGG + Intronic
1052603467 9:30670437-30670459 TTCTAAAAGCCATACCTGAAAGG + Intergenic
1053646512 9:40122880-40122902 TTCTAAAAGCCATACCTGAAGGG - Intergenic
1054327523 9:63720782-63720804 TTCTAAAAGCCATACCTGAAGGG - Intergenic
1054538058 9:66253093-66253115 TTCTAAAAGCCATACCTGAAGGG + Intergenic
1057567565 9:96178793-96178815 TTCTGGAAGCAAAAGCAGGAAGG + Intergenic
1202794298 9_KI270719v1_random:106311-106333 TTCTAAAAGCCATACCTGAAGGG - Intergenic
1203438602 Un_GL000195v1:167040-167062 TTCTGTAAGGGATTGCTGGAAGG - Intergenic
1185850936 X:3485934-3485956 TTGCGGAAGTGATACCTGGTGGG - Intergenic
1186760941 X:12721070-12721092 TTCAGGAAGCAATAGCTGAAGGG - Exonic
1193027546 X:76861001-76861023 TTCTGGAAAGAATACCTAGAGGG + Intergenic
1201149023 Y:11085115-11085137 TTCTAAAAGCCATACCTGAAGGG + Intergenic