ID: 946299474

View in Genome Browser
Species Human (GRCh38)
Location 2:218813929-218813951
Sequence GAGTGGGTGTATGCAAAATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 158}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946299474_946299477 -3 Left 946299474 2:218813929-218813951 CCACATTTTGCATACACCCACTC 0: 1
1: 0
2: 0
3: 18
4: 158
Right 946299477 2:218813949-218813971 CTCATACACCCTCCCATTACTGG 0: 1
1: 0
2: 0
3: 13
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946299474 Original CRISPR GAGTGGGTGTATGCAAAATG TGG (reversed) Intronic
900742710 1:4340372-4340394 CAGTGGGTGTTTGAAGAATGAGG + Intergenic
900754953 1:4427095-4427117 GTGTGAGTGTATACAAGATGGGG + Intergenic
902153404 1:14463105-14463127 GGGTGGGTTAATGCAAATTGAGG + Intergenic
902260117 1:15218834-15218856 GGGTGGGTTAATGCAAATTGAGG - Intronic
905764939 1:40592499-40592521 GGGTGGGTTAATGCAAATTGAGG - Intergenic
910297824 1:85669222-85669244 GAGTGGGTGCAAGCCAAAAGAGG + Intronic
911999420 1:104812257-104812279 GAGTGGGGGTAAGTAAAACGTGG - Intergenic
913235552 1:116778385-116778407 GGATGGGTGTCTGCAAACTGGGG - Intergenic
914360209 1:146928697-146928719 GAATGGGGGTATGAAAAAAGAGG + Intergenic
914493539 1:148171200-148171222 GAATGGGGGTATGAAAAAAGAGG - Intergenic
918321431 1:183368864-183368886 AAGTGAGTCTGTGCAAAATGGGG + Intronic
919248550 1:195021256-195021278 GAGTAGGTGATTGGAAAATGAGG + Intergenic
920452162 1:206067692-206067714 GAGGGGGTATGTGCAGAATGAGG - Intronic
922808998 1:228405813-228405835 GAGTGGGGGCAAGGAAAATGTGG - Intronic
1064710903 10:18123421-18123443 GAGTGGGTTAATGCAAATGGAGG - Intergenic
1065264277 10:23958729-23958751 GAGCGAGTTTAGGCAAAATGGGG + Intronic
1065529912 10:26658568-26658590 AAGTGGCTGCATGCAAAAGGGGG + Intergenic
1065557036 10:26926557-26926579 AAGTGGCTGCATGCAAAAGGGGG - Intergenic
1066038661 10:31521850-31521872 GAGTAGGTGTATGCCACCTGGGG - Exonic
1066248442 10:33608638-33608660 GAGTAGGTAAATGTAAAATGGGG + Intergenic
1067460143 10:46452220-46452242 AAGTGGGTGATGGCAAAATGGGG - Intergenic
1067627047 10:47932383-47932405 AAGTGGGTGATGGCAAAATGGGG + Intergenic
1068260225 10:54571021-54571043 GATTGTGTGTATCCAAAGTGAGG + Intronic
1068627897 10:59269118-59269140 GAGGGGGTGTATGCAATTTCTGG - Intronic
1068903604 10:62298123-62298145 GAGTGGATGTACCCACAATGTGG - Intergenic
1071231907 10:83597738-83597760 GAGTGGGTGTATGTAAAAGAGGG - Intergenic
1071491710 10:86140755-86140777 GAGGGGCTGTCTGTAAAATGGGG + Intronic
1073807364 10:107112272-107112294 GAGTTCTTGTATGCAAAATAAGG + Intronic
1075087577 10:119423726-119423748 GAGTGTGTGTGTGCAGGATGGGG - Intronic
1077950866 11:6955183-6955205 TTGTGGCTGTATGGAAAATGGGG + Intronic
1082083648 11:48031534-48031556 GATTGGGGTCATGCAAAATGGGG + Intronic
1083535766 11:63465404-63465426 GTGTGTGTGTATCCAAGATGTGG + Intronic
1086778271 11:90867550-90867572 CAGTGGGAGTAAGGAAAATGAGG + Intergenic
1088176711 11:107060743-107060765 AAGTGGGTGTGTGCAAAGAGGGG - Intergenic
1089742798 11:120596666-120596688 GAGTATGTGTAGGGAAAATGAGG + Intronic
1090042569 11:123303613-123303635 GTGTGTGTGTATGCAAAGCGAGG + Intergenic
1090787326 11:130061233-130061255 TAGTGGGGGTGTGCAGAATGGGG + Intergenic
1091387151 12:102777-102799 GCGTGGGTGTCTGCAAAGGGAGG + Intronic
1091392988 12:137137-137159 GAGTGGGTGTCTCAAGAATGGGG - Intronic
1096899769 12:54864423-54864445 GAGTGGTTTTATGAAGAATGTGG - Intergenic
1100162173 12:91873042-91873064 GTGTGTGTGTGTGCAAAATTTGG + Intergenic
1100638129 12:96455637-96455659 CAATTGGTGTAAGCAAAATGGGG - Intergenic
1102819065 12:115892630-115892652 GAGTGGGGGAAAGGAAAATGTGG + Intergenic
1102876093 12:116449918-116449940 GAGCTGGTTTAGGCAAAATGAGG - Intergenic
1103025938 12:117574058-117574080 GAGTGGTGGTTTGCAAACTGGGG + Intronic
1103114893 12:118318838-118318860 CAGTGGGTGAATGGAAAATGTGG + Intronic
1105796262 13:23856509-23856531 GGGTGGGTTAATGCAAATTGGGG + Intronic
1107803872 13:44135914-44135936 GAGAGGGTGTATGGACAAAGAGG - Intergenic
1111625277 13:90776766-90776788 GATTGGGTGGATGTGAAATGAGG - Intergenic
1112022133 13:95380718-95380740 GAGTGGGTTAATGCAAATTGAGG + Intergenic
1112108661 13:96270168-96270190 GAGTGTGTGTGTGCACAAAGAGG + Intronic
1112583574 13:100697167-100697189 GAGTGGGTTAATGCAAATTTGGG + Intergenic
1112751485 13:102588329-102588351 GGGTGGGTTAATGCAAACTGAGG + Intergenic
1113147888 13:107229151-107229173 GAGTGTGTGTGTCTAAAATGTGG - Intronic
1113181792 13:107637128-107637150 GAGTGTGTTTAAGCAAAATGAGG - Intronic
1113490521 13:110688144-110688166 GAGTGGGTGGGGGCAAACTGAGG - Intronic
1115069977 14:29309751-29309773 GAGTAGGTGTTTGCATCATGGGG + Intergenic
1115137908 14:30133153-30133175 CAGTGTGTGCATGCAGAATGAGG - Intronic
1115536584 14:34379014-34379036 GATTGGTGGTATGCAAAATGTGG - Intronic
1115984152 14:39086189-39086211 TTGTGGTTGTATTCAAAATGTGG - Intronic
1118240071 14:64047380-64047402 GGGTGGGTATATGTAAAATAGGG + Intronic
1119275024 14:73347515-73347537 GAGTGAATGGATGCAAAATAAGG - Intronic
1123683744 15:22782810-22782832 ACGTGGGTGGATTCAAAATGAGG + Intronic
1129094335 15:73187316-73187338 GACTTGGTGTATGAATAATGAGG - Intronic
1134220660 16:12351220-12351242 GAGTGTGTGAACGCAAAGTGGGG + Intronic
1134901770 16:17944578-17944600 GGTTGGGTTTCTGCAAAATGTGG - Intergenic
1138098180 16:54230121-54230143 GAGTGGGTGAGTGCAGAGTGGGG + Intergenic
1138170157 16:54841624-54841646 CAGAGGGCGTATGAAAAATGAGG + Intergenic
1138716225 16:59026118-59026140 GATGGTGGGTATGCAAAATGGGG + Intergenic
1142003210 16:87675827-87675849 GAGTGGGTGTATGAAAGGTGAGG - Intronic
1142152670 16:88519610-88519632 GAGTGGGTGGATGCATGATTAGG + Intronic
1142158017 16:88541555-88541577 GGGTGGGTTAATGCAAATTGAGG + Intergenic
1144492757 17:15728653-15728675 GTGTGTGTGTATGTAAAATGTGG - Intergenic
1144907496 17:18648003-18648025 GTGTGTGTGTATGTAAAATGTGG + Intronic
1149377135 17:56055518-56055540 GTGTGTGTGTATGCCTAATGTGG + Intergenic
1149520922 17:57317845-57317867 GAGTGGTTGAAAGCAGAATGTGG + Intronic
1150444448 17:65217685-65217707 GTGGGGGTGTTTGCCAAATGAGG + Intronic
1151122387 17:71807703-71807725 GAGTAGCTGTGTGAAAAATGAGG + Intergenic
1153917871 18:9761763-9761785 GAGAGGGAGTATGAAAAAAGAGG + Intronic
1157482251 18:48062931-48062953 GAGCAGGTGAAGGCAAAATGCGG - Intronic
1157762054 18:50272624-50272646 GAGTGGGTGTTGGCCAGATGTGG - Intronic
1158966703 18:62628412-62628434 GAGGGTGTGTAAGGAAAATGTGG - Intergenic
1159108474 18:64029312-64029334 GAGTGGGTTAATGCAAATTGAGG + Intergenic
1159246992 18:65819232-65819254 GAGTGGGTCAATGCAGATTGAGG - Intronic
1161656342 19:5517876-5517898 GGGAGGGTGGATGGAAAATGAGG - Intergenic
1161755011 19:6126391-6126413 GTGTGTGTGTAAGCAAAATTAGG - Intronic
1162001767 19:7749111-7749133 GGGTGGGTCAATGCAAATTGAGG - Intergenic
1163576743 19:18115335-18115357 CAGTGGGTGTATGTAATAGGGGG + Intronic
1165979427 19:39707120-39707142 GAGTGTGTGTCTGCACAATGGGG + Intronic
925398499 2:3554193-3554215 GAGTGTGTGAAAACAAAATGTGG - Intronic
931202152 2:60108031-60108053 GAATGGATATAAGCAAAATGTGG - Intergenic
933014016 2:77101377-77101399 GAGTGCGTACATACAAAATGAGG + Intronic
933486888 2:82935445-82935467 GGGTGGGTCAATGCAAATTGAGG - Intergenic
933522750 2:83393383-83393405 GAATGGGTATATGCCAGATGAGG + Intergenic
937805973 2:126146089-126146111 GAGTGGGTGTAATGAAAATCAGG + Intergenic
941467109 2:165841128-165841150 GTGTGTGTGTGTGTAAAATGGGG - Intergenic
942397503 2:175567439-175567461 CATTGTGTGTATGGAAAATGGGG + Intergenic
944240555 2:197481315-197481337 GAGCGGGGGGATGCAAGATGGGG + Intergenic
946299474 2:218813929-218813951 GAGTGGGTGTATGCAAAATGTGG - Intronic
1173700696 20:45068613-45068635 GAGTGTGTTTGTGAAAAATGTGG - Intronic
1173891978 20:46519782-46519804 GAGTGGATCAATGCAAATTGAGG - Intergenic
1177589795 21:23147861-23147883 GTGTGTGTGTATATAAAATGAGG + Intergenic
1178160464 21:29905988-29906010 GAGTGTGTGTATGCATTTTGGGG + Intronic
1178734975 21:35141045-35141067 GGCTGGGATTATGCAAAATGGGG + Intronic
1178803984 21:35823511-35823533 GAGAGAGTGGATGCAAAATTAGG - Intronic
1182735887 22:32532215-32532237 GAGTGCGTGTGTGCCAAATCTGG + Intronic
1184976399 22:48065498-48065520 AAGAGGGCGTTTGCAAAATGAGG + Intergenic
950944734 3:16933481-16933503 GAGTGGGTGAAGTCAAAATGGGG - Intronic
954983351 3:54766511-54766533 GATTGTGGGAATGCAAAATGGGG + Intronic
955192486 3:56774227-56774249 GAGTGGCTTTAGGCAAGATGGGG - Intronic
956170797 3:66431980-66432002 GACAGGCAGTATGCAAAATGGGG - Intronic
956221081 3:66903958-66903980 CAGCGCCTGTATGCAAAATGAGG - Intergenic
956495607 3:69822717-69822739 GGGTGGGTGAATTCAAAATGTGG - Intronic
959065473 3:101652549-101652571 GAACGGGTGTGTGAAAAATGTGG - Exonic
959289671 3:104457825-104457847 GTGTGTGTGTGTGCAAAATGAGG - Intergenic
967087967 3:186110929-186110951 GAGTGGGGGTAGACAAAATTGGG - Intronic
969091831 4:4699999-4700021 GAGTGGGACTATAAAAAATGAGG + Intergenic
971958089 4:33449086-33449108 GCATGTGTGTATGCACAATGTGG + Intergenic
972102984 4:35445743-35445765 CAGTGGGTGTATGCAAACACTGG + Intergenic
972766689 4:42158048-42158070 GTGTGTGTGTGTGTAAAATGTGG + Intergenic
981259585 4:142703929-142703951 GAGATGGTGTATCCAAAATCTGG + Intronic
981451542 4:144904023-144904045 GATGGGGAGTATGCTAAATGTGG - Intergenic
981548839 4:145921693-145921715 GAGTGGGTTCATGGACAATGAGG + Intronic
981816337 4:148834922-148834944 GAGTGGGTGAAGACAAAAAGTGG - Intergenic
982973872 4:162026996-162027018 TAGAGGATATATGCAAAATGGGG + Intronic
983995783 4:174180184-174180206 GTCTGTGTGTATGAAAAATGAGG - Intergenic
985783519 5:1882616-1882638 GAGTAGGGGTATCCAAACTGCGG + Exonic
991612683 5:68465283-68465305 GAGGGGGTGTATGGAAAGGGAGG + Intergenic
995901984 5:117080549-117080571 GAGTGGGGGTCTGAAATATGTGG - Intergenic
996662973 5:126026474-126026496 AAGAAGCTGTATGCAAAATGTGG + Intergenic
996965185 5:129299687-129299709 GTGTTGGTGTATGCATGATGGGG - Intergenic
997065446 5:130554186-130554208 GGGTGGGTCAATGCAAATTGAGG - Intergenic
997661777 5:135594727-135594749 GAGTGGGTGAATACAAAACCTGG + Intergenic
1000112218 5:158119829-158119851 GAGTTGGTGTTTGCCAAGTGTGG + Intergenic
1000982721 5:167833952-167833974 GAGTTTGTGTTTGTAAAATGAGG - Intronic
1003016247 6:2469710-2469732 GCATGTGTGTGTGCAAAATGGGG + Intergenic
1003045877 6:2732324-2732346 GAGTGGGTATTTGAAATATGGGG - Intronic
1003412363 6:5876840-5876862 GAGTGGGTATATGCATAACAGGG - Intergenic
1005256966 6:24013701-24013723 GAGTGGAGGTAAGCAAAGTGAGG + Intergenic
1010675913 6:78742752-78742774 GGGTGGGTTAATGCAAATTGAGG - Intergenic
1010756385 6:79670276-79670298 GATTGGGAGTAGGCAAAATATGG - Intronic
1013163407 6:107567932-107567954 GAGTGGGTGTGTGGAAGAAGGGG + Intronic
1016709433 6:147153142-147153164 TAGTGGTTGTTTGCTAAATGAGG - Intergenic
1017145427 6:151230190-151230212 GAGTGGGTGTCTGGAAAGGGTGG + Intergenic
1024747671 7:52427161-52427183 GGGTGGGTTAATGCAAATTGAGG - Intergenic
1026609033 7:71840866-71840888 GAAAGGATGTATCCAAAATGTGG - Intronic
1028317910 7:89427065-89427087 GGGTGGGTCAATGCAAATTGGGG + Intergenic
1029045741 7:97626291-97626313 GAGTGGGGGCATGAAAATTGGGG - Intergenic
1030416401 7:109249277-109249299 GAAAGGGTGAATGCAACATGAGG - Intergenic
1030532785 7:110730843-110730865 AAGAGGGTGTCTGCAAACTGAGG - Intronic
1033764255 7:144471010-144471032 CAGTGTGTGTGTGCAAAATTAGG + Intronic
1034483383 7:151341043-151341065 ATGTGTGTGTATGTAAAATGGGG - Intergenic
1035954710 8:4063970-4063992 GAGTGTGTGTTGGGAAAATGGGG + Intronic
1037454907 8:19053321-19053343 GAGTGGGTGTGTGCAGCAGGGGG - Intronic
1037473987 8:19238111-19238133 GAGAGGGTGAAGGCAAAATGCGG + Intergenic
1039072016 8:33657455-33657477 GGGTAGGTATATGCAAAATAGGG - Intergenic
1041644619 8:60238816-60238838 GAGTGGGCATAAGCAGAATGGGG - Intronic
1043519813 8:81032833-81032855 GAATGGGTATATACAAAATGTGG + Intronic
1044045707 8:87429330-87429352 GGGTGGGTGTCTGTAAAAGGTGG + Intronic
1045527414 8:102953074-102953096 GTGTGGGGTTATCCAAAATGAGG - Intronic
1046160316 8:110354443-110354465 CAGGGTGTGTATGCACAATGTGG + Intergenic
1046437778 8:114215951-114215973 GATTGGGTGTAGGAAAAATGTGG + Intergenic
1047957877 8:129989193-129989215 CAGTGGGTCTCTGGAAAATGGGG + Intronic
1049810862 8:144569883-144569905 TAGTGGGTGTGGGGAAAATGAGG + Intronic
1051934098 9:22423221-22423243 GAGTGAGTCCATGCAAAATTTGG + Intergenic
1055035878 9:71817993-71818015 GAGAGGGGGAATGAAAAATGGGG - Intergenic
1055079494 9:72255226-72255248 GGGTGGGTGGATGCAAATTGAGG + Intronic
1058924325 9:109647002-109647024 GAGTGAGAGAATGGAAAATGGGG - Intronic
1059678235 9:116561044-116561066 GAGAGGGTGTAGGGAAAATAAGG + Intronic
1186199714 X:7144904-7144926 GTTTTGGTGTATGTAAAATGTGG - Intronic
1187765010 X:22631901-22631923 GAGTGAGAGTATCAAAAATGTGG + Intergenic
1188218799 X:27514326-27514348 GTGTGTGTGTATGACAAATGAGG - Intergenic
1195373931 X:104207065-104207087 GGGTGGGTTAATGCAAATTGAGG + Intergenic
1195597659 X:106711110-106711132 AAGTGGGTGTTTTGAAAATGAGG - Intronic
1198212237 X:134527099-134527121 TGGAGGGTGAATGCAAAATGAGG - Intergenic
1199077311 X:143538267-143538289 GAGCGTGTTTATGTAAAATGTGG + Intergenic
1199488593 X:148374120-148374142 GAAAGGGTGTATGCAAGATGGGG - Intergenic