ID: 946301727

View in Genome Browser
Species Human (GRCh38)
Location 2:218828145-218828167
Sequence GTGTCTCAGCACAAGGACAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 185}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946301727_946301733 -8 Left 946301727 2:218828145-218828167 CCAGTGTCCTTGTGCTGAGACAC 0: 1
1: 0
2: 1
3: 13
4: 185
Right 946301733 2:218828160-218828182 TGAGACACAGTGGGGACTGTGGG 0: 1
1: 0
2: 4
3: 31
4: 401
946301727_946301736 6 Left 946301727 2:218828145-218828167 CCAGTGTCCTTGTGCTGAGACAC 0: 1
1: 0
2: 1
3: 13
4: 185
Right 946301736 2:218828174-218828196 GACTGTGGGAACAGGACAGTGGG 0: 1
1: 2
2: 168
3: 1483
4: 2579
946301727_946301732 -9 Left 946301727 2:218828145-218828167 CCAGTGTCCTTGTGCTGAGACAC 0: 1
1: 0
2: 1
3: 13
4: 185
Right 946301732 2:218828159-218828181 CTGAGACACAGTGGGGACTGTGG 0: 1
1: 0
2: 6
3: 40
4: 363
946301727_946301738 19 Left 946301727 2:218828145-218828167 CCAGTGTCCTTGTGCTGAGACAC 0: 1
1: 0
2: 1
3: 13
4: 185
Right 946301738 2:218828187-218828209 GGACAGTGGGGCAGCCCCCCAGG 0: 1
1: 0
2: 1
3: 30
4: 277
946301727_946301737 7 Left 946301727 2:218828145-218828167 CCAGTGTCCTTGTGCTGAGACAC 0: 1
1: 0
2: 1
3: 13
4: 185
Right 946301737 2:218828175-218828197 ACTGTGGGAACAGGACAGTGGGG 0: 1
1: 0
2: 9
3: 41
4: 303
946301727_946301735 5 Left 946301727 2:218828145-218828167 CCAGTGTCCTTGTGCTGAGACAC 0: 1
1: 0
2: 1
3: 13
4: 185
Right 946301735 2:218828173-218828195 GGACTGTGGGAACAGGACAGTGG 0: 1
1: 0
2: 37
3: 640
4: 2016
946301727_946301734 -2 Left 946301727 2:218828145-218828167 CCAGTGTCCTTGTGCTGAGACAC 0: 1
1: 0
2: 1
3: 13
4: 185
Right 946301734 2:218828166-218828188 ACAGTGGGGACTGTGGGAACAGG 0: 1
1: 0
2: 3
3: 36
4: 357

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946301727 Original CRISPR GTGTCTCAGCACAAGGACAC TGG (reversed) Intronic
900577078 1:3388749-3388771 GGGTCTCACCCCAAGGACATAGG - Intronic
902927337 1:19704808-19704830 GAGTCTCAGTTCAAGGTCACAGG - Intronic
903739614 1:25551098-25551120 CTTTCTCAGCACAAGGCCCCAGG - Intronic
905467785 1:38168685-38168707 ATGTCTCAGCTCAAGCAGACGGG - Intergenic
914917944 1:151829812-151829834 ATGTGTCAGCACAAGGGCAGGGG - Intronic
915958638 1:160245037-160245059 GTCTCTAAGCACAAAGACAAAGG + Intronic
918421072 1:184364635-184364657 ATGTCTCAGATCAAGGAGACAGG + Intergenic
920114042 1:203607333-203607355 TTGAGGCAGCACAAGGACACCGG + Intergenic
923688227 1:236169082-236169104 GAGCCTCAGCAGAAGGAAACAGG + Intronic
924757434 1:246954107-246954129 GTTTCTGAGCACAGGGACACTGG + Intronic
1064703878 10:18050254-18050276 AGGTCACAGCCCAAGGACACGGG + Intergenic
1065871890 10:29962858-29962880 GTGTCTTGGCCCAAGGATACTGG - Intergenic
1065993694 10:31036597-31036619 GCTTCTCAGAACAAGGACACAGG - Intergenic
1067296298 10:44976943-44976965 GTGTTTCAGAACAAGGCCTCGGG - Exonic
1070739423 10:78892923-78892945 GTGTCTCAGCACCAGTGCTCAGG - Intergenic
1072785054 10:98273610-98273632 CTGTCTCAGCAGCTGGACACAGG + Intergenic
1076201290 10:128560711-128560733 ATGTCTAATCACAAGGACCCAGG - Intergenic
1076470684 10:130716154-130716176 GTGTCTAAGAACAAGCCCACAGG - Intergenic
1076672955 10:132133151-132133173 GTGCCTCAGCCCAGGGCCACGGG + Intronic
1076698473 10:132258127-132258149 GTGTCCCAGCCCCAGGACATCGG + Intronic
1078113904 11:8426045-8426067 CTGCCTCATCACAAGGACAGAGG + Intronic
1079392060 11:20031084-20031106 CTGTTTCAGGACCAGGACACAGG + Intronic
1083313646 11:61800460-61800482 GTTTGTCAACACAAAGACACAGG - Exonic
1085980089 11:81714398-81714420 AGGTCACAGCACAAGGATACAGG - Intergenic
1086375347 11:86194679-86194701 GTGTTTCACAACAAGGACTCAGG - Intergenic
1089587062 11:119516678-119516700 GTGTCTTACCACAGGGATACAGG - Intergenic
1090306264 11:125693720-125693742 CTGTCTCAGCCCAGGGCCACAGG - Intergenic
1091293706 11:134457633-134457655 GTGTCACAGCACAGAGACAGAGG - Intergenic
1091293734 11:134457863-134457885 GTGTCACAGCACAGAGACAGAGG - Intergenic
1091763798 12:3105142-3105164 TTGTCTGAACACAAAGACACAGG - Intronic
1093283067 12:17219921-17219943 GTGTTTCAGCACAAATACATTGG + Intergenic
1095417403 12:41991456-41991478 GTGTGTCAACACTTGGACACAGG - Intergenic
1096766424 12:53894111-53894133 GTGTTTCAGCCCAAGGCCCCTGG + Intergenic
1098377050 12:69827384-69827406 GTGTCTCAGGAAAATGACAAGGG + Intronic
1098396825 12:70028443-70028465 GTGCCTCATCGCAAGGACAGAGG + Intergenic
1099295389 12:80822757-80822779 GTCTCTCAGCACAAAGAGCCAGG + Intronic
1099680752 12:85824854-85824876 GTGTTTCAGGACAAGGCAACAGG - Intronic
1102783233 12:115583674-115583696 GTGTTTCAGCAGAAGGAAAGTGG - Intergenic
1102955341 12:117055032-117055054 GTGCCTCAGCTCTGGGACACTGG + Intronic
1103849462 12:123922491-123922513 GTGTCTCAGCAGAAGAGGACTGG - Intronic
1108771633 13:53709115-53709137 ATATCTCAGCAGAAGGACCCTGG + Intergenic
1111067614 13:83117137-83117159 TTGTCTCAGGAGAAGGACAAAGG - Intergenic
1112967210 13:105211592-105211614 GTTTCTCAGCATCTGGACACTGG - Intergenic
1119749597 14:77068004-77068026 GTGGCTCAGCACATGGGCTCTGG - Intergenic
1121502109 14:94446304-94446326 GTGTCACAGCAGAAGGATGCTGG - Intronic
1121596085 14:95163761-95163783 GTGTCACAGAACAGGGAGACAGG - Intergenic
1121857292 14:97281924-97281946 GTGTCTCACCTCAAGCACTCAGG + Intergenic
1128769079 15:70268492-70268514 GGGTCTCAGGACAAGGAGAGTGG - Intergenic
1128924940 15:71646743-71646765 CTGTCAAAGCATAAGGACACTGG + Intronic
1130235766 15:82132214-82132236 CTGCCTCAGCACCAGGACACAGG - Intronic
1130418616 15:83718353-83718375 GAGTCTCATCAGAAGGACTCAGG + Intronic
1130682685 15:86010360-86010382 GTGCCTTATCACAAGGACAGAGG + Intergenic
1133650672 16:7810566-7810588 GTGTCTCATCCTAAGAACACAGG + Intergenic
1136512367 16:30746840-30746862 GGGGCTTATCACAAGGACACAGG - Intergenic
1136849297 16:33601119-33601141 GTGTCTGAGCACAGGAACAGAGG + Intergenic
1137820641 16:51441547-51441569 GTAACTCTGCACAAGGAAACTGG + Intergenic
1138165477 16:54797462-54797484 ATGTCTCAGCTCAAGGAAAGAGG + Intergenic
1138473721 16:57258403-57258425 GGGTCTCAGCCCCAGGACTCAGG - Intronic
1138555921 16:57771152-57771174 GTGCCTCAGCCCAAGGCCCCTGG - Intronic
1141134996 16:81459339-81459361 GGGTCACAGCACAGGGCCACGGG - Intronic
1142115121 16:88352505-88352527 ATGGCTCAGCACCAGGCCACTGG + Intergenic
1203111004 16_KI270728v1_random:1449769-1449791 GTGTCTGAGCACAGGAACAGAGG + Intergenic
1142584714 17:964793-964815 ATCTATCAGCACAAGGACAGTGG + Intronic
1143739307 17:8941077-8941099 GTGTGTCAGCAGCAGGACAATGG + Intronic
1145888038 17:28396359-28396381 TTGTCTCAGCCCAGGGAGACTGG - Exonic
1148596828 17:48863260-48863282 GGGTCTCAGTACAAGGGCCCTGG + Exonic
1148640724 17:49185320-49185342 TGGACTCAGCACAAGGACCCTGG - Intergenic
1149268347 17:54951879-54951901 CTGACTCTCCACAAGGACACAGG + Intronic
1157187421 18:45552443-45552465 GTGTCCCAGCTTGAGGACACGGG - Intronic
1158138518 18:54231824-54231846 GTGTTTCAGAACAAGGTCACTGG - Intergenic
1158629411 18:59099250-59099272 TTATCGCAGCAAAAGGACACAGG - Intergenic
1158856084 18:61544373-61544395 CTGCCTTATCACAAGGACACAGG + Intronic
1160070526 18:75623896-75623918 GGGTCTAGGCACGAGGACACAGG + Intergenic
1161899680 19:7109277-7109299 CTGACTCAGGACAAGAACACGGG - Intergenic
1162382344 19:10339027-10339049 CTGTCTCGGCACAAGGAGAGAGG - Intronic
1165499354 19:36175538-36175560 GGGTCATAGCAAAAGGACACAGG + Intergenic
1165762288 19:38328466-38328488 GTGTGACTGCCCAAGGACACAGG - Exonic
1167529682 19:50007513-50007535 TCGTCTCAGCACCAGGACAGTGG - Intronic
925176115 2:1785072-1785094 GTGTCTCACCGCAATGAGACGGG - Intergenic
927099932 2:19780363-19780385 GTGTCTCTGCACCAGCAAACTGG + Intergenic
927578263 2:24218926-24218948 GTGTCTTATCACACGGACAGTGG - Intronic
928376806 2:30781591-30781613 GTGTCTCAGCTCAAGGAGTCAGG - Intronic
928497164 2:31845155-31845177 GTGTTTCAGCACAAATACCCGGG - Intergenic
931344624 2:61434375-61434397 GTTTCTCAGGTCTAGGACACAGG - Intronic
933913998 2:86970222-86970244 GTGTCTCAGCACACTTACAGAGG - Intronic
934008995 2:87799676-87799698 GTGTCTCAGCACACTTACAGAGG + Intronic
935470682 2:103456162-103456184 GTGTCCCAGCTCCAGGACACCGG - Intergenic
935772584 2:106440367-106440389 GTGTCTCAGCACACTTACAGAGG + Intronic
935907488 2:107855547-107855569 GTGTCTCAGCACACTTACAGAGG - Intronic
935993890 2:108747702-108747724 GTGTCTCAGCACACTTACAGAGG - Intronic
936129278 2:109820689-109820711 GTGTCTCAGCACACTTACAGAGG - Intronic
936215419 2:110550796-110550818 GTGTCTCAGCACACTTACAGAGG + Intronic
936424556 2:112405369-112405391 GTGTCTCAGCACACTTACAGAGG + Intronic
938235640 2:129704256-129704278 GAGGGTCAGCACAAGCACACAGG - Intergenic
942256909 2:174112183-174112205 GTATCTCAGCACTGGGGCACTGG - Intronic
944213378 2:197229807-197229829 GTGGTTAAGCACATGGACACTGG - Intronic
944622679 2:201533069-201533091 GACTCTCAGCCCAAGGAAACAGG + Intronic
945165572 2:206939458-206939480 ATGTCTCAGCAGAAAGTCACGGG - Intergenic
946301727 2:218828145-218828167 GTGTCTCAGCACAAGGACACTGG - Intronic
946734264 2:222738940-222738962 ATGACTCAGCACAAGAAGACAGG - Intergenic
947367370 2:229410415-229410437 GTGTGTCAGCCAAAGTACACTGG - Intronic
948365305 2:237450800-237450822 GGGTCTCAGGCCAAGGCCACAGG + Intergenic
1170574160 20:17649931-17649953 GTGTCCCAGCCCTAGCACACAGG - Intronic
1170740564 20:19052267-19052289 GTATCTCAGAAACAGGACACTGG + Intergenic
1172696710 20:36828043-36828065 GTGTCTCAGTCCAAGGACACTGG + Intronic
1173482911 20:43417009-43417031 GTTTCTCAGGCCCAGGACACAGG - Intergenic
1175732438 20:61362957-61362979 GTGACACGGCACAAGGGCACAGG - Intronic
1175772013 20:61629918-61629940 GTGACTCAGCGCAAGGAGTCAGG + Intronic
1176024373 20:62978350-62978372 GTGTCTCAGCAGAGGGAGATGGG - Intergenic
1176248050 20:64106737-64106759 GTCTCTCAGGACAATGGCACTGG - Exonic
1177179417 21:17728509-17728531 GTATCTCTCCACAAGGACAGAGG + Intergenic
1178358490 21:31928643-31928665 GTGTCACCGCACACGGACATAGG + Intronic
1178813868 21:35909312-35909334 GTCTTTCAGAGCAAGGACACAGG + Intronic
1179547001 21:42119135-42119157 ATGTGTCAGCACATGGACGCTGG + Exonic
1179948544 21:44696923-44696945 TTGTCCCAGCACAAGGCCCCAGG - Intronic
1180946062 22:19694193-19694215 GTGCCTCAGGACACAGACACAGG + Intergenic
1183149046 22:36022982-36023004 CTGTGGCAGCCCAAGGACACTGG + Intronic
1184556697 22:45237053-45237075 GGGCCTCAGCCCAAGCACACAGG - Intronic
1184721156 22:46314273-46314295 GTGCCTGAGAACATGGACACTGG + Intronic
1184907253 22:47497228-47497250 GTGTGTCAGCACGAAGACAAAGG - Intergenic
949659238 3:6258612-6258634 CTGACTCAGCACAAGAAAACAGG - Intergenic
951259803 3:20494831-20494853 GTGACTCAGCACAGAGAGACAGG - Intergenic
952551630 3:34485179-34485201 CTGTCTCAAGACAAGGACACTGG + Intergenic
952970234 3:38646135-38646157 GTCTCTCAGCAGAAAGAAACAGG + Intronic
953772205 3:45786498-45786520 GTGCCTCTGGACAAGGACACAGG - Intronic
954455810 3:50599318-50599340 GTGGGGCAGCCCAAGGACACAGG - Intergenic
955480593 3:59385557-59385579 CTGTCTTATCACAAGGACAGAGG - Intergenic
956326575 3:68059644-68059666 GTGTGTCTGCACAATGACAGAGG + Intronic
957610919 3:82464008-82464030 ATATCTCAGCTCAAGGACTCAGG - Intergenic
959556654 3:107727221-107727243 GTGTCCCAGTAAAAGCACACGGG - Intronic
960749897 3:120936963-120936985 AGGTCACAGCCCAAGGACACAGG - Intronic
961136175 3:124513398-124513420 GTGACTCAGCATGGGGACACGGG + Intronic
964209183 3:154209608-154209630 GTGACTCAGAACAAAGACAGAGG - Intronic
964472663 3:157071106-157071128 GTTTCTGAGGAAAAGGACACAGG - Intergenic
965634903 3:170770952-170770974 GAGCCTCAGCACAAGGGGACAGG + Intronic
967184328 3:186931732-186931754 GTGTCTGGGCACACGGACACGGG - Intronic
967662757 3:192133243-192133265 GTGTCCCAGCTCAAGGAGATAGG + Intergenic
969348943 4:6586984-6587006 CTGTCTTTGCAGAAGGACACGGG + Exonic
970142897 4:13001933-13001955 GTGTCTCAGCTCAAGCAGTCAGG - Intergenic
974220268 4:58960278-58960300 TTTTCAAAGCACAAGGACACAGG - Intergenic
974741906 4:66018064-66018086 GTTTCACACCACAATGACACTGG + Intergenic
975512827 4:75212342-75212364 GTGTCTCTGCACTTGGCCACAGG - Intergenic
977125998 4:93168889-93168911 GGCTCTGAGCAAAAGGACACTGG + Intronic
981423828 4:144581222-144581244 CTGTCTTATCACAAGGACAGTGG - Intergenic
981853386 4:149257959-149257981 GTATCTTGGCAGAAGGACACAGG + Intergenic
986453533 5:7891675-7891697 GTGGCTGGGCACACGGACACAGG - Intronic
987409703 5:17602856-17602878 GTGTCTTACCAAAAGGACACAGG + Intergenic
990503311 5:56419168-56419190 GTATCTCAGCACTAGGGCAATGG - Intergenic
991454975 5:66793292-66793314 GTGTCCCAGCAGGCGGACACTGG - Intronic
993661667 5:90645191-90645213 CAGTCTCAGCACCGGGACACGGG + Intronic
994554590 5:101282399-101282421 ATGTCTTAGCACAAGGAAGCAGG + Intergenic
1000135230 5:158341871-158341893 GTGTTTTACCACAAAGACACAGG + Intergenic
1000434762 5:161194828-161194850 AGGTCTCAGCGGAAGGACACTGG + Intergenic
1000550528 5:162656938-162656960 GTGCCTCTGCATAAGGAGACTGG - Intergenic
1001296177 5:170500659-170500681 GTGTCTAAGTAGAAGAACACAGG - Intronic
1001853359 5:174989060-174989082 GTGTCTCTCCATTAGGACACAGG - Intergenic
1002685467 5:181005855-181005877 CTGTCTCATCCCCAGGACACTGG - Exonic
1003170125 6:3714760-3714782 GTGTCTTACCACATGGACACTGG + Intergenic
1006053940 6:31366846-31366868 GTGTCTCAGAACATGGGCATCGG - Intergenic
1010251660 6:73713615-73713637 GTGTCTGAGCAGTAGGACCCAGG + Intronic
1010335240 6:74673853-74673875 GTGTCTAAGAACAAAGATACTGG - Intergenic
1011652133 6:89516299-89516321 ATGTCTCAGCTCATGGACTCAGG - Intronic
1016697560 6:147015809-147015831 GTGTAGCAGCACAAGGACATGGG - Intergenic
1016889275 6:148989513-148989535 GTTTCTCTGAACAAGGACAAAGG - Intronic
1018332610 6:162747550-162747572 ATGTATCAGCACCAGTACACTGG + Intronic
1022027911 7:26466040-26466062 GTGTCTGAGCAAAAGGAAAGAGG + Intergenic
1033892816 7:146036386-146036408 GTGTCTCTGCACAAGTAGACTGG + Intergenic
1034479559 7:151308983-151309005 TCCTCTCAGCACATGGACACGGG - Intergenic
1035091841 7:156319323-156319345 CTGTGTCAACACAAGTACACTGG - Intergenic
1035596163 8:859635-859657 CTGTCTCAGCACCAGGCCTCTGG + Intergenic
1035607371 8:938769-938791 GTGTCTCAGCACAGGGGCCACGG + Intergenic
1035748915 8:1981706-1981728 GTGTCCCAGCTCCAGGACAGGGG - Intronic
1036183160 8:6602160-6602182 GTCTTTCTGCTCAAGGACACTGG - Intronic
1036186139 8:6624057-6624079 GTGACTCCACACAAGGACGCAGG - Intronic
1039734647 8:40318240-40318262 GTGTCTCATGACAAGGCAACTGG + Intergenic
1042335186 8:67622505-67622527 GTGTCTCATTACAAGGGCCCAGG - Intronic
1044797851 8:95922251-95922273 GTGCCGGAGCACAAGGAGACTGG - Intergenic
1044911177 8:97060902-97060924 ATGTCTCTGCACAAAGAAACTGG - Intronic
1045617920 8:103939438-103939460 GTGTCACAGCACAGGGACCGTGG + Intronic
1045980358 8:108179332-108179354 AAGTCACAGCCCAAGGACACAGG + Intergenic
1048428389 8:134343684-134343706 GTTTCTCAGCAAAGAGACACTGG - Intergenic
1049207044 8:141368427-141368449 GAGTATCAGCAGAAGCACACGGG - Intergenic
1049210034 8:141381747-141381769 CTGTCTCAACACAAGGCCTCAGG + Intergenic
1049674205 8:143882619-143882641 GGGCCTCAGCAGCAGGACACGGG - Intergenic
1051690988 9:19712087-19712109 GTGTCTCAGCACAAAAAGTCTGG + Intronic
1051981362 9:23023518-23023540 AGGTCACAGCCCAAGGACACAGG - Intergenic
1052055881 9:23906912-23906934 GTGACTCATCACAAGAACATGGG - Intergenic
1052414265 9:28157395-28157417 TTGATCCAGCACAAGGACACTGG + Intronic
1052889279 9:33682701-33682723 GAGTGACGGCACAAGGACACAGG - Intergenic
1055936251 9:81607196-81607218 GTGCCTAAGGACAAGGACAGTGG - Intronic
1057858884 9:98624284-98624306 AAGTCTCAGCACAAGGATGCAGG + Intronic
1060708458 9:125831793-125831815 GAGTCTTATCAGAAGGACACAGG - Intronic
1060796061 9:126513935-126513957 GAGTCTCTGCACAAGGCCAGGGG - Intergenic
1061536975 9:131256456-131256478 GTGTCTCAGCCCCAGGAGGCAGG + Intergenic
1062063643 9:134514271-134514293 AGGTCTCAGTACAAGGACAAAGG - Intergenic
1062130872 9:134892405-134892427 GACTCTCAGCCCAAGGAGACAGG - Intergenic
1192329151 X:70160124-70160146 GTGTCTCAGCCCCAGGGAACTGG - Intronic
1192406743 X:70893543-70893565 GTGTCCCAGCACAACAACCCTGG - Intronic
1194188766 X:90808435-90808457 GTACCTCAGCACAAGCACAGTGG - Intergenic
1200535348 Y:4390332-4390354 GTACCTCAGCACAAGCACAGCGG - Intergenic