ID: 946302348

View in Genome Browser
Species Human (GRCh38)
Location 2:218831708-218831730
Sequence GGTCCCAGGGGAGCCGGAGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 455
Summary {0: 1, 1: 0, 2: 5, 3: 45, 4: 404}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946302348_946302360 11 Left 946302348 2:218831708-218831730 CCGGCTCCGGCTCCCCTGGGACC 0: 1
1: 0
2: 5
3: 45
4: 404
Right 946302360 2:218831742-218831764 CGCAGTGCGTGCTCCAGCCCGGG 0: 1
1: 0
2: 1
3: 15
4: 166
946302348_946302361 21 Left 946302348 2:218831708-218831730 CCGGCTCCGGCTCCCCTGGGACC 0: 1
1: 0
2: 5
3: 45
4: 404
Right 946302361 2:218831752-218831774 GCTCCAGCCCGGGCTCCATGTGG 0: 1
1: 0
2: 0
3: 33
4: 375
946302348_946302359 10 Left 946302348 2:218831708-218831730 CCGGCTCCGGCTCCCCTGGGACC 0: 1
1: 0
2: 5
3: 45
4: 404
Right 946302359 2:218831741-218831763 GCGCAGTGCGTGCTCCAGCCCGG 0: 1
1: 0
2: 1
3: 6
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946302348 Original CRISPR GGTCCCAGGGGAGCCGGAGC CGG (reversed) Intronic
900113859 1:1020473-1020495 GTCGCCAAGGGAGCCGGAGCGGG - Intronic
900191897 1:1355597-1355619 GGTCCCAGTGGAGCACGCGCTGG + Exonic
900328087 1:2120620-2120642 GGTCCCAGGGGAGAGAGAACAGG - Intronic
900422854 1:2563096-2563118 AGTCCCAGGGGGGCCTGAGCAGG + Intronic
900601356 1:3504103-3504125 GGCCCCAGGGGAGGCAGAGGAGG + Intronic
900601369 1:3504131-3504153 GGCCCCAGGGGAGGCAGAGGAGG + Intronic
900615450 1:3563668-3563690 GGTGTCAGGGGAGCCAGAGGGGG - Intronic
900643153 1:3696880-3696902 GGTGGCAGGGGGGCCGGAGGCGG - Intronic
901057165 1:6453993-6454015 GGCCACAGGGGAGCTGGAGAAGG + Intronic
901144734 1:7057268-7057290 GGACCCAGGGGAACCGGGACGGG - Intronic
901158264 1:7155132-7155154 GGTCCCTGGGAAGCCTGTGCCGG + Intronic
901232109 1:7647090-7647112 GGTCCCTGGAGAGCAGGTGCTGG - Intronic
901530749 1:9851059-9851081 GGCCCCAGGTGACCTGGAGCAGG + Intronic
902292451 1:15444423-15444445 GGTCCCAGAGGGTCAGGAGCAGG - Intronic
902404463 1:16175186-16175208 GGGCCCTGGGGTGCCGGGGCTGG + Intergenic
902477201 1:16694500-16694522 GGCCACAGGGGAGCTGGAGAAGG - Intergenic
903318606 1:22527908-22527930 TGTCCCAGGCTGGCCGGAGCTGG - Exonic
903337836 1:22636744-22636766 GGACCCAGGGGAGCTGGCCCAGG + Intronic
903438111 1:23367958-23367980 GGTCCCAGGTAAGCCGGAGGTGG - Exonic
903614794 1:24643675-24643697 GGGCCTAGCGGAGCCGGAGGAGG + Intronic
904701945 1:32362940-32362962 GGTTCCAGGCCAGCGGGAGCAGG - Intronic
905878506 1:41448634-41448656 GGCCCCAGGGGAGTGTGAGCTGG + Intergenic
906166415 1:43689717-43689739 GGTCCCAGCTGAGACTGAGCTGG - Intronic
906476669 1:46173912-46173934 GGTCCCAGGGCCGCAGGGGCAGG + Intronic
906668528 1:47638536-47638558 GGATTCAGGGGAGCTGGAGCTGG + Intergenic
906673982 1:47679933-47679955 GGTCCAAGGGGAGCCACTGCTGG + Intergenic
909623435 1:77689964-77689986 GGTCCCAGCTGAGCCTGAGGTGG + Intergenic
912361638 1:109100494-109100516 GGTCCCCGAGGTCCCGGAGCTGG + Intergenic
912438526 1:109679973-109679995 GGTCCCAGGATAGGCGGAGATGG - Intronic
912576547 1:110676522-110676544 GTGCCCAGGAGAGCCGGAGGTGG - Intergenic
915098111 1:153478398-153478420 GCTCCCAGGGCAGCCACAGCAGG + Intergenic
915285918 1:154851941-154851963 GGTCACAGGGGAGGCGGGTCTGG - Intronic
915367894 1:155325570-155325592 GGTTCCAAGGGAGCGGGTGCTGG - Exonic
915380155 1:155433240-155433262 TGGGCCAGGGGGGCCGGAGCCGG + Intronic
915507921 1:156369095-156369117 GGGCCCCGGGGACCAGGAGCGGG - Intergenic
916335900 1:163671041-163671063 GTTCCCAGTGAAGCCGAAGCTGG + Intergenic
917565297 1:176206937-176206959 TGTCCCAGCGGAGCCCGACCCGG + Exonic
918216092 1:182392420-182392442 AGACCCAAGAGAGCCGGAGCGGG - Intergenic
920945786 1:210527225-210527247 GCTTCCAGGGGAGTCTGAGCTGG - Intronic
921039542 1:211416681-211416703 GGGCCCCGGGCGGCCGGAGCTGG + Intergenic
922500493 1:226093875-226093897 AGTGCAAGGGGAGCCGGAGTTGG - Intergenic
924440778 1:244083434-244083456 GGGGCCAGAGGAGCTGGAGCAGG + Intergenic
1063018750 10:2104920-2104942 GGGCACAGGGCAGCCGGAGGCGG + Intergenic
1063368965 10:5508536-5508558 GGACCCAGGGCAGCCGGTGAGGG - Intergenic
1066695044 10:38069775-38069797 GGTCACAGGGGAGAAGGAGATGG + Intergenic
1066745872 10:38604018-38604040 GGGCTCAGTGGAGCCTGAGCCGG + Intergenic
1066997468 10:42577404-42577426 GGTCACAGGGGAGAAGGAGACGG - Intronic
1067227488 10:44385304-44385326 GGGCCCAGCGGAGCCTGAGAAGG - Intronic
1067478082 10:46579200-46579222 GGTCGCAGAGGGGCCGGGGCTGG - Intronic
1067561695 10:47309011-47309033 AGCCCCAGGGAAGCCGGAGCTGG + Intronic
1067616658 10:47762587-47762609 GGTCGCAGAGGGGCCGGGGCTGG + Intergenic
1067960947 10:50848784-50848806 GGACCCAAGGGAACAGGAGCAGG - Intronic
1069688696 10:70335461-70335483 TGGGCCAGGGCAGCCGGAGCTGG - Intronic
1069877786 10:71573805-71573827 GGCCCCAGGGGAGCCGGGCCAGG - Intronic
1069962725 10:72087935-72087957 GGTCCCAGGGCCGCCGGCCCGGG + Intronic
1070646337 10:78204665-78204687 GTTCCCAGGAGAGAAGGAGCTGG - Intergenic
1070953808 10:80451776-80451798 GGACCCAGGGGAACCAAAGCAGG - Intergenic
1071337193 10:84610463-84610485 GGTCCCAGGCATGCCTGAGCTGG - Intergenic
1072549108 10:96463690-96463712 GGTCCCAAGGGAGCTGGAGCTGG - Intronic
1072625892 10:97111727-97111749 GCTCCCAGGTGAGCTGCAGCAGG - Intronic
1073190423 10:101646910-101646932 AGTCCCAGTGGAGCCGGAGTTGG + Intronic
1074776811 10:116773173-116773195 GGTCCCAGGGAGGCAAGAGCAGG + Intergenic
1075504506 10:123009673-123009695 CCGCCCAGGGGAGCCGGAGCCGG + Intronic
1075587644 10:123669104-123669126 GGTCCCAGGGCACTGGGAGCAGG - Intronic
1075705430 10:124497511-124497533 GGACCCAGGGGAGCCCCACCCGG - Intronic
1076221632 10:128738501-128738523 GGGCCAAAGGGAGCCGGAGGCGG - Intergenic
1076252187 10:128993720-128993742 GGACCCAGAGGGGCTGGAGCAGG - Intergenic
1076258210 10:129045313-129045335 TGGTCCAGGGAAGCCGGAGCAGG - Intergenic
1076899198 10:133328806-133328828 GTTCCCAGGGGAGCCTGAGAAGG + Intronic
1077374534 11:2199345-2199367 GAGCCCAGTGGAGACGGAGCTGG - Intergenic
1077415262 11:2421770-2421792 GGTCCCAGGTGAGTGGGAGCAGG + Intronic
1077571183 11:3339695-3339717 GGTCCCAGAGGACACGGAGGTGG + Intronic
1078250764 11:9614504-9614526 GGCCCCACCGGAGCCGGTGCCGG - Intergenic
1079158700 11:17973259-17973281 GGTCCCACAGGAGCAGGATCAGG + Intronic
1081657271 11:44865797-44865819 GGTCTCAGTGGAGCAGGAACAGG + Intronic
1082010814 11:47448672-47448694 GGACACAGGGGAGCCCGAGGAGG + Intronic
1082884178 11:58066460-58066482 GGTCCCATGGAAGCCCCAGCAGG - Intronic
1083669299 11:64291500-64291522 GGTGGCAGAGGAGCCGGAGAGGG - Intronic
1083759869 11:64810007-64810029 GGGCCGAGAGGAGCCGGACCTGG - Exonic
1083903322 11:65654475-65654497 GCCCCCAGTGGAGCAGGAGCTGG + Exonic
1084284077 11:68120709-68120731 GGGGCCGGGGGAGCCGGGGCCGG - Intronic
1084555896 11:69875601-69875623 GGGGCCAGGGGACCCAGAGCAGG - Intergenic
1084972868 11:72781212-72781234 GGACCCAGGAGAGCCGGACTAGG - Exonic
1085257481 11:75183953-75183975 GGTCCCAGTGAAGATGGAGCAGG + Intronic
1085274898 11:75292083-75292105 GCTCCCAGGGGAGGTGGGGCGGG - Intronic
1085384869 11:76151813-76151835 GGCCCCAGGGCTGCAGGAGCAGG - Intergenic
1085512611 11:77095919-77095941 GGTCCCAGGGAGGCCAGGGCGGG + Intronic
1085529521 11:77183236-77183258 GGGCCCACGGAAGCAGGAGCAGG + Intronic
1086491262 11:87359879-87359901 GGTCCGAGGGGAGTCGGTGGGGG - Intergenic
1088588355 11:111379491-111379513 GGTCCCCGCGGGGCCGGTGCAGG - Exonic
1088644642 11:111908001-111908023 GGCCCCGGGGGAGCAGGAGATGG - Intergenic
1088689219 11:112311091-112311113 GGGCCGAGGGGAGCCTGGGCTGG + Intergenic
1089665239 11:120013952-120013974 GTACCCAGGGCAGCCGGAGTGGG + Intergenic
1091203390 11:133800272-133800294 AATCCTAGGGGAGCAGGAGCAGG + Intergenic
1091219111 11:133920071-133920093 GAGCTCAGGGGAGCCGGTGCGGG + Exonic
1092396912 12:8134770-8134792 TGGGCCAGGGGGGCCGGAGCCGG - Intronic
1092527067 12:9315809-9315831 GGTCCCAGGACAGCAGGTGCTGG - Intergenic
1092530388 12:9339322-9339344 AGCCCCAGGGGAGCAGGGGCTGG + Intergenic
1092540202 12:9415963-9415985 GGTCCCAGGACAGCAGGTGCTGG + Intergenic
1094512840 12:31106493-31106515 GGTCCCAGGACAGCAGGTGCCGG - Intergenic
1096226499 12:49869749-49869771 GCTCCCAGGGAAGTGGGAGCTGG - Exonic
1096231320 12:49898343-49898365 GGTCCCCAGGGAGCCCCAGCCGG - Intronic
1098443926 12:70546826-70546848 AGTCCCAGGGAAGCTGGAGGAGG + Intronic
1099202359 12:79690915-79690937 GCTCCCAGGTGTGCCGAAGCTGG + Exonic
1100468896 12:94873363-94873385 GGCGTCAGGGGAGCCGGAGAAGG + Intergenic
1100722276 12:97371582-97371604 TGCCTCTGGGGAGCCGGAGCTGG + Intergenic
1102036163 12:109771595-109771617 AGCCCCTGGGGAGCAGGAGCCGG + Intergenic
1102058654 12:109915596-109915618 AGGCCCAGGGGAGCAGGGGCCGG - Intronic
1103074212 12:117969104-117969126 GGTCCCTGGCGCGCCGGGGCCGG - Intergenic
1103306563 12:119969756-119969778 TGGCCCAGGGGAACCGAAGCAGG - Intergenic
1103510990 12:121474068-121474090 GGGACCAGGGGAGGGGGAGCAGG + Intronic
1104081001 12:125430538-125430560 GCTCCCAGGGAAGGTGGAGCTGG + Intronic
1104084419 12:125461149-125461171 GTACCCAGGAGAGCCAGAGCTGG + Intronic
1104286198 12:127426928-127426950 GTACCCAGGAGAGCCAGAGCTGG - Intergenic
1104380111 12:128299928-128299950 GGTGCCAGTGGAACCGGGGCAGG + Intronic
1105388941 13:19958387-19958409 GGGCCCCGAGGAGCCGAAGCGGG + Intergenic
1110642061 13:77836528-77836550 TGTCCCAGTGGAACCGAAGCAGG - Intergenic
1113494037 13:110713964-110713986 GGTCCCCGCGGACCCGGAGGCGG + Intronic
1113659137 13:112092795-112092817 GGTCCCAGAGGAGCCCGGGCAGG - Intergenic
1113665869 13:112141983-112142005 AGGCCCAGGGGAGCCGTGGCTGG - Intergenic
1113835492 13:113326026-113326048 GGTCCTCGGGGAGCTGGTGCGGG - Exonic
1114267327 14:21080677-21080699 GGGCCCAGGGGAGGAGCAGCTGG + Exonic
1114613745 14:24057760-24057782 GGTCTCAGGGGAGCTGGAAGGGG - Intronic
1118385352 14:65251626-65251648 GGTCCCAGGGGCAAAGGAGCAGG - Intergenic
1119385845 14:74257743-74257765 GCTTCCTGGGGAGCGGGAGCTGG - Intronic
1121241062 14:92430536-92430558 GGGCCCAGGGAAGCTGGAGGAGG - Intronic
1121951838 14:98177630-98177652 GGGCTCAGGGGGGTCGGAGCAGG + Intergenic
1122558419 14:102593375-102593397 GGTCCCCGGCGAGCCCGAGGGGG + Intronic
1122794310 14:104198362-104198384 GGTCTCAACGGAGCCTGAGCTGG + Intergenic
1123091561 14:105744379-105744401 GGTCCCAGCGGACCCTGGGCAGG - Intergenic
1202854832 14_GL000225v1_random:43709-43731 TGTCCCAGGGGAGCCTGTGGTGG + Intergenic
1124169582 15:27360669-27360691 GGCTGCAGGGGAGCAGGAGCAGG - Intronic
1124500898 15:30225584-30225606 GGGCCCAGGAGGGCCGGAGGCGG + Intergenic
1124742672 15:32313083-32313105 GGGCCCAGGAGGGCCGGAGGCGG - Intergenic
1124835789 15:33194867-33194889 GGTGGCAGGGGAGGCGGGGCGGG + Intergenic
1126798652 15:52280975-52280997 GGTAACAGGGGAGCAGGAGCTGG - Intronic
1128526244 15:68414305-68414327 GGTCCCTGGGGGGACGGGGCTGG + Intronic
1128550597 15:68595860-68595882 GGACCCTGGTGAGACGGAGCGGG + Intronic
1129051228 15:72783543-72783565 GGTCCCGGGGGCGCAGGCGCGGG + Exonic
1129873962 15:78960239-78960261 GGTCCCAGGGGAGGCGGCCTTGG + Exonic
1130062036 15:80577254-80577276 GGACCCAAGTGAGCTGGAGCTGG + Intronic
1130535865 15:84784568-84784590 GGTCACGGGCGTGCCGGAGCAGG - Exonic
1131174370 15:90201068-90201090 GGTCCCAGAGGAGCCGGAAGGGG + Intronic
1131180205 15:90234079-90234101 GGTCCTAGGCGAGCTGGAGGCGG + Exonic
1132143839 15:99415223-99415245 GGTCTCAGGAGCCCCGGAGCTGG - Intergenic
1132381245 15:101368271-101368293 GGCCCCAGGGGAGCGGGAGAGGG + Intronic
1132600218 16:769767-769789 GGTCCCAGGAGAGCAGCCGCAGG - Intronic
1132660366 16:1058335-1058357 GGTCCCAGGGAGGCCGGCGCTGG + Intergenic
1132747576 16:1443371-1443393 GGGGCCAGTGGTGCCGGAGCTGG - Intronic
1132821638 16:1875500-1875522 GGTCCCACGGGAGGCTGAGGTGG - Intronic
1133008482 16:2897516-2897538 GGGCCCTGGGGAGTGGGAGCAGG - Intronic
1133099373 16:3469993-3470015 GGCCCCAGGGCAGCCCCAGCAGG - Intronic
1134094702 16:11411715-11411737 GGTCCCATGGGAGTCCCAGCAGG + Intronic
1134640826 16:15827954-15827976 GGCCCCAGAGGAGCTGGAGATGG - Intronic
1134747157 16:16597185-16597207 GGTCAGAGGGGAGCCAGTGCAGG + Intergenic
1134998318 16:18756474-18756496 GGTCAGAGGGGAGCCAGTGCAGG - Intergenic
1136186685 16:28592561-28592583 GGTCCCAGGGGTCGAGGAGCTGG - Intronic
1136419504 16:30123119-30123141 GGTCCCGGGGGAGGTGGAGATGG - Exonic
1136637936 16:31537582-31537604 GGTCCCAGGTGAGCTGCGGCCGG - Intergenic
1136666790 16:31819571-31819593 GGTCCCAGGTGAGCTGCGGCCGG + Intergenic
1138223539 16:55273256-55273278 GGGCCCAGGAGAGCCAGTGCTGG - Intergenic
1138460047 16:57142691-57142713 TGTCCCAGTGGAGGGGGAGCTGG + Intronic
1138489281 16:57366813-57366835 GGTCCCAGGGGCCCTGGAGGTGG + Intergenic
1138522592 16:57579418-57579440 GAACCCAGGGGCGCTGGAGCTGG + Intronic
1139603555 16:68001597-68001619 GGGCCCTGGGGTGCAGGAGCTGG + Intronic
1141137339 16:81474783-81474805 GGTGCCAGGGGAGCCAGCCCAGG + Intronic
1142213804 16:88821260-88821282 GGCCCCAGGTGAGCCGAGGCTGG + Intronic
1142253215 16:89002258-89002280 GGGGACAGAGGAGCCGGAGCCGG + Intergenic
1142253275 16:89002434-89002456 GGGGACAGAGGAGCCGGAGCCGG + Intergenic
1142253383 16:89002735-89002757 GGGGACAGAGGAGCCGGAGCCGG + Intergenic
1142253445 16:89002911-89002933 GGGGACAGAGGAGCCGGAGCCGG + Intergenic
1142253466 16:89002968-89002990 GGGGACAGAGGAGCCGGAGCCGG + Intergenic
1142253494 16:89003042-89003064 GGGGACAGAGGAGCCGGAGCCGG + Intergenic
1142253527 16:89003133-89003155 GGGGACAGAGGAGCCGGAGCCGG + Intergenic
1142256159 16:89014810-89014832 GGGCCCTGGGGAGCCCCAGCAGG - Intergenic
1142741420 17:1934026-1934048 GGCCACAGGGGAGCAGGTGCAGG + Intergenic
1143089344 17:4439804-4439826 GGACCCAGTGGGGCTGGAGCTGG - Intronic
1143100685 17:4503152-4503174 GGTCACACGGGGGGCGGAGCAGG + Intronic
1143608240 17:8003122-8003144 GGGCCCGGGGGAGGCGGGGCAGG - Exonic
1143653987 17:8282456-8282478 AGTCCCAGGGAAGCTGAAGCAGG - Intergenic
1144675447 17:17158684-17158706 GGAGCCTGGGGAGCTGGAGCGGG + Exonic
1145252832 17:21305728-21305750 GTCCACAGGGGAGCCAGAGCGGG - Intronic
1145323743 17:21782188-21782210 GTCCACAGGGGAGCCAGAGCGGG + Intergenic
1146662220 17:34672436-34672458 GGTTCCAGGGGACCCTGAGAAGG + Intergenic
1146905955 17:36618042-36618064 GGTCCCAGTGGAGCAGCAGCTGG + Intergenic
1147676720 17:42211607-42211629 GGTCCCATAGGAGCCTGATCTGG + Intronic
1148157298 17:45431583-45431605 GGTCCAAGGGGAGGGGGCGCCGG - Intronic
1148333239 17:46824712-46824734 GGGCCCAGAGGAGAGGGAGCAGG + Intronic
1148496258 17:48054983-48055005 AGCCCCAGGGCAGCCGGTGCCGG - Intronic
1148836046 17:50466488-50466510 GGTGCCAGGGGAAGAGGAGCTGG - Intronic
1148857051 17:50584581-50584603 GGGCCCAGGGGAGCCGGGGGCGG + Intronic
1149600369 17:57889409-57889431 GGCCCCAGGGGAGGCTGGGCTGG + Intronic
1149610581 17:57955497-57955519 GGGCCCGGGGGCGCCGCAGCCGG - Intergenic
1150840374 17:68600997-68601019 GGGCCCCGGGGCGCCGGCGCCGG + Exonic
1151398106 17:73838466-73838488 GGTCCCAGGGGAGCCAGTGAGGG - Intergenic
1151673805 17:75588111-75588133 GGCCTCAGGGGAGCAGGAGTCGG + Intergenic
1151701232 17:75743641-75743663 GGTCACAGGAGAGCAGGAGGTGG + Intronic
1151825869 17:76523836-76523858 GGGCCCAGGCAAGCCAGAGCTGG - Intergenic
1152070477 17:78131621-78131643 GGCCCCTGGGGTGCCGGAGCCGG + Exonic
1152135555 17:78501290-78501312 CGTCCCAGCGATGCCGGAGCTGG + Exonic
1152334640 17:79693476-79693498 GGGCACAGGGGAGCCTGGGCAGG + Intergenic
1152426637 17:80221625-80221647 GGCCGCAGGGGAGCAGCAGCAGG - Exonic
1152527716 17:80898698-80898720 GGTGCGGGGGGAGCCGGGGCGGG - Intronic
1152611727 17:81318198-81318220 GGTCCCGGGGCAGGCGGAGGCGG - Intronic
1152627477 17:81394174-81394196 GGTCCCGCGGGAGCGGGAGTGGG + Intergenic
1152697663 17:81804817-81804839 GGCGCCGGGGGGGCCGGAGCCGG - Intronic
1155761516 18:29574621-29574643 GGTCCCAGGTGAGCCTGTACTGG + Intergenic
1156526676 18:37774565-37774587 GGTCCCAGAGCATCCAGAGCAGG + Intergenic
1156802640 18:41136460-41136482 GGTCAGAGGGAAGCCTGAGCAGG + Intergenic
1157598610 18:48879005-48879027 GCACCCAGGGCAGCCTGAGCAGG + Intergenic
1157706876 18:49814258-49814280 GGGGCCAGGGGACCTGGAGCAGG + Intronic
1158732857 18:60044916-60044938 GGACACAGGGGAGCAGCAGCAGG + Intergenic
1159369834 18:67516398-67516420 GGCCCCAAGGGAGACGGAGGTGG + Exonic
1160847835 19:1174129-1174151 GGTCGCGGTGGAGCCGGGGCGGG + Intronic
1161048883 19:2151590-2151612 GGTCCCAGCCGAGCCGGCCCCGG + Intronic
1162562305 19:11423803-11423825 GGCCCCAGGGGTGCCTAAGCCGG - Intronic
1162789919 19:13057519-13057541 GGGCCCTGGGGAGCCGAGGCTGG - Intronic
1162799530 19:13103050-13103072 GGCCCCAGGGCAGCCGGGGAGGG + Intronic
1163404240 19:17112583-17112605 GGTCCCAAGGGAGGAGGAGAGGG + Intronic
1163610926 19:18301199-18301221 GGTTCCAGTGGAGGCGGGGCAGG + Intergenic
1163654829 19:18539583-18539605 GGTGCAGGAGGAGCCGGAGCTGG - Exonic
1163667719 19:18610955-18610977 GTTCCCGGGGGAGCCGGTCCAGG - Intronic
1163715587 19:18870449-18870471 GGTCCCAGGGGAGGTGGCGGCGG + Exonic
1163764158 19:19153122-19153144 GGTCCCACGAGAGCAGCAGCAGG + Intronic
1164623336 19:29710704-29710726 GGGCACAGGGTAGCCAGAGCAGG - Intronic
1164728037 19:30479949-30479971 GGTTCCAAGGGAGCCCGCGCTGG + Intronic
1164740405 19:30571647-30571669 GGTCACAGAGAAGCAGGAGCAGG - Intronic
1165253618 19:34559349-34559371 GGTCCCGGGGGAGGGGGTGCCGG + Intergenic
1165384362 19:35501823-35501845 GGACCCAGGGGAGCCACGGCTGG - Intronic
1165894185 19:39131631-39131653 CATCCCAGGGGAGCCAGCGCTGG + Intronic
1165944810 19:39435745-39435767 GGTAACATGGGAGCTGGAGCCGG - Intronic
1166305010 19:41932562-41932584 AGTCCCCGGGGAGCCGGGCCTGG + Intergenic
1166336973 19:42114167-42114189 GGTCCCTGGGGAGCTGGGGGAGG + Intronic
1166364755 19:42272794-42272816 GTTCCCAGGGGGGGCGCAGCAGG - Intronic
1166729255 19:45049309-45049331 TGTCCCAGGGCAGAGGGAGCTGG + Intronic
1166852564 19:45767565-45767587 GGTTACAGGGAAACCGGAGCTGG + Intronic
1166871357 19:45872866-45872888 GCTCCCAGGGGAGCTGAAGCTGG + Exonic
1166947201 19:46404537-46404559 GGCCCCAGGAGGGCCGGGGCAGG + Intergenic
1167455513 19:49595383-49595405 GGTCCCAGCGGAGCCACGGCTGG + Exonic
1167475903 19:49700874-49700896 GGTCCCAGGAGAGCCTGAGCAGG - Intronic
1167576569 19:50320560-50320582 GGTCCCAGGGGATCAGTAGGGGG + Intronic
1168144883 19:54415441-54415463 GGGCTCAGGGGAGCGGGAGCGGG - Intronic
1168339589 19:55615502-55615524 GGGCGCAGGGCAGCTGGAGCCGG - Exonic
1168406814 19:56114785-56114807 GGTACCAGGGCAGCAGGTGCTGG - Intronic
1202711217 1_KI270714v1_random:20326-20348 GGCCACAGGGGAGCTGGAGAAGG - Intergenic
925173436 2:1766765-1766787 GCTCCCAGAGGAGCAGGTGCAGG + Intergenic
925328753 2:3042454-3042476 GGTCCCAGGGGAGCCGCCTCGGG - Intergenic
925559114 2:5168827-5168849 GGTCCCAGTGTAGCAGAAGCAGG + Intergenic
926757854 2:16250376-16250398 GTGCCCAGGGGAGCTGGAACTGG - Intergenic
927209893 2:20632649-20632671 GGTCCTGGGGGAGCCTGAGGCGG + Intronic
927506677 2:23619520-23619542 GGCCCCAGGGCAGCCGAAGCAGG + Intronic
928172860 2:29014561-29014583 GGTACCTGGGGAGCGGGAGGAGG + Exonic
929692648 2:44087307-44087329 GGGCCCAGGGGAAGCGGACCTGG - Intergenic
930014232 2:46959477-46959499 TGTCACAGGGGAGCCTGAGCTGG + Intronic
931637636 2:64355124-64355146 GGTCCCACAGGGCCCGGAGCTGG + Intergenic
932509415 2:72270304-72270326 GGTCTCAGGGGATCCTGAGCAGG + Intronic
934308275 2:91843211-91843233 GGGCTCAGTGGAGCCTGAGCCGG + Intergenic
934661313 2:96145093-96145115 GGTCCGCGGGGAGCTGGCGCGGG - Exonic
934662477 2:96150471-96150493 GGTCACAGGGGAGCCCCAGGAGG - Intergenic
935299598 2:101682462-101682484 GGTCCCAGGAGACTCAGAGCTGG + Intergenic
936556912 2:113503918-113503940 GGTCCAAGGGGCGCGGGGGCCGG + Intergenic
942965874 2:181891947-181891969 GGGCCCCGGGGAGCTGAAGCGGG - Exonic
944414927 2:199471117-199471139 TATCCCAGGGCATCCGGAGCTGG + Intronic
946302348 2:218831708-218831730 GGTCCCAGGGGAGCCGGAGCCGG - Intronic
947118622 2:226796392-226796414 GCGCCCCGGGGAGCCGGAGGAGG - Exonic
947637868 2:231689176-231689198 GGTGCCAGGGGACTCGGAGTAGG - Intergenic
947739768 2:232479786-232479808 GTCCCCAGGGCAGGCGGAGCTGG - Intergenic
948172444 2:235915559-235915581 GGTCCCAGGGGAGACTGAGGTGG + Intronic
948462010 2:238134338-238134360 GGTCCCAGGAGAGCCTGGGGTGG + Intergenic
948650514 2:239440618-239440640 GCTCCCAGGCGAGCCCGAGCTGG - Intergenic
948690118 2:239696749-239696771 GGCCCCTGGGGAGGCAGAGCGGG - Intergenic
948694254 2:239725266-239725288 GGCACCAGGGGAGCCTGAGGAGG + Intergenic
1169194389 20:3675386-3675408 GTTCCCAGGGGACCTGCAGCAGG + Intronic
1170567335 20:17614594-17614616 AGCCCCAGGGGAGGCAGAGCTGG - Intronic
1172227781 20:33316771-33316793 GGTCCTAGGAGAGGCAGAGCTGG + Intergenic
1172786034 20:37469509-37469531 GGTCCCAGGAGAACAGGAGAAGG - Intergenic
1172786046 20:37469563-37469585 GGTCCTAGGGGAGCAGGAGAAGG - Intergenic
1172943965 20:38674056-38674078 GGACCCAGGGTAGCGGGATCCGG + Intergenic
1172991988 20:39043263-39043285 GACCCCAGGAGAGCAGGAGCTGG + Intergenic
1173498524 20:43535849-43535871 GCCCCCAGGGGAGGCAGAGCTGG - Exonic
1173872732 20:46351953-46351975 GGGCCCTGGGGTGCAGGAGCTGG + Intronic
1174135442 20:48375934-48375956 GCTCCCATGGGGGCCAGAGCTGG - Intergenic
1175259868 20:57667573-57667595 TGTCCCAGGGGAGGGGCAGCTGG + Intronic
1175382036 20:58570047-58570069 GGTCCCAGGGGTGCCCAAGTGGG - Intergenic
1175384167 20:58583696-58583718 TACCCCAGGGGAGCAGGAGCAGG + Intergenic
1175916613 20:62428778-62428800 GTTCCCAGGCCAGCCAGAGCTGG - Intergenic
1175926085 20:62472292-62472314 GGTCCCAGTGGAGCAGGTGGTGG - Intronic
1176143686 20:63556026-63556048 GGTCCCCGAGCAGCAGGAGCTGG - Exonic
1176165079 20:63668554-63668576 GGTCTGAGGGGAGCCTCAGCAGG + Intronic
1176521757 21:7829733-7829755 GGACCCGGGGGGGCCGGGGCTGG - Intronic
1178655777 21:34459745-34459767 GGACCCGGGGGGGCCGGGGCTGG - Intergenic
1179106396 21:38404466-38404488 GGGCCCGGGGGAGAAGGAGCAGG + Intronic
1179178692 21:39027113-39027135 GACCCCAGGGGAGCCACAGCAGG + Intergenic
1179921941 21:44512219-44512241 GGTCACTGGGGAGCCGGAGGAGG + Intronic
1179988587 21:44934071-44934093 GGTCCCAGGTGAGGCGGATGTGG + Intronic
1180206002 21:46261028-46261050 GGTGTCAGGGGAGCTGGAGTAGG - Intronic
1180535359 22:16390290-16390312 GGGCTCAGTGGAGCCTGAGCCGG + Intergenic
1180765838 22:18345486-18345508 GGTCCCAGGGCATCCTGGGCTGG + Intergenic
1180780473 22:18516892-18516914 GGTCCCAGGGCATCCTGGGCTGG - Intronic
1180813191 22:18774213-18774235 GGTCCCAGGGCATCCTGGGCTGG - Intergenic
1181199366 22:21208529-21208551 GGTCCCAGGGCATCCTGGGCTGG - Intronic
1181274105 22:21677679-21677701 AGACCCTGGGGAGCGGGAGCGGG + Intronic
1181407561 22:22695445-22695467 GATGCCATGGGAGCCTGAGCTGG - Intergenic
1181478078 22:23180789-23180811 GGTGGCAGGTGAGGCGGAGCGGG - Exonic
1181879270 22:25964829-25964851 GGTCGCAGGGCAGCTGGAGAAGG + Intronic
1183400677 22:37602120-37602142 GGTCCTTGGGGAGCTAGAGCAGG + Intergenic
1183676083 22:39299589-39299611 GGTCTCAGGGGAGGCTGAACAGG - Intergenic
1183738462 22:39656946-39656968 AGTCCCAGGGGAGCCGTGGCAGG + Intronic
1183744875 22:39686354-39686376 GCTCCCCGGAGAGCTGGAGCCGG + Exonic
1183831472 22:40420483-40420505 GGGCCCAGGGGCGCCCGAGCTGG + Exonic
1183868471 22:40722987-40723009 GGTGCTAGAGGAGCCGGAGGGGG + Intergenic
1184115045 22:42417401-42417423 GGTCCCATGGGATCTGGGGCAGG + Intronic
1184804923 22:46788557-46788579 GGTCCCAGTGGGGCTGGTGCTGG - Intronic
1185217365 22:49609132-49609154 TGTTCCTGGGGAGCCGAAGCAGG - Intronic
1185223902 22:49642444-49642466 GCTCCCAGGGAAGCCAGGGCTGG + Intronic
1203227459 22_KI270731v1_random:86377-86399 GGTCCCAGGGCATCCTGGGCTGG + Intergenic
950438497 3:12994175-12994197 GGGCGCTCGGGAGCCGGAGCCGG + Intronic
950462842 3:13135522-13135544 TGTCCCAGGGGCACCAGAGCTGG - Intergenic
952888140 3:38024407-38024429 AGTGCCTGGGGATCCGGAGCCGG - Exonic
953626904 3:44579285-44579307 GGAGCCTGGGGAGCTGGAGCGGG - Intronic
955911516 3:63863710-63863732 GGTCTCAGGGGAGGCCCAGCGGG + Intronic
957553335 3:81734954-81734976 GATCCCAGGTGAGATGGAGCTGG - Intronic
957875980 3:86147190-86147212 GCTCTCTGGGGAGCTGGAGCAGG - Intergenic
962738790 3:138348394-138348416 GGGCCCAGGGGACTCGGCGCGGG + Intronic
963746725 3:149131604-149131626 GGGCCTAGGGCAGCCTGAGCAGG - Intronic
966787842 3:183636456-183636478 CGTCCCCGGGGAGCCGGGGCGGG + Intronic
966863216 3:184241969-184241991 GGTCCCAGTGGCGCAGTAGCAGG - Exonic
966904082 3:184509126-184509148 GCTCCCAGGGAAGCTGCAGCTGG + Intronic
967191161 3:186985909-186985931 GGTCCCAGGGGAGGCTAAGCTGG + Intronic
968051554 3:195658240-195658262 GGTCCGAGCGGAGCGGGCGCCGG + Intergenic
968089995 3:195893684-195893706 GGTGCCTGGGGAGCTGGAGAGGG - Intronic
968104263 3:195990093-195990115 GGTCCGAGCGGAGCGGGCGCCGG - Intergenic
968302564 3:197627683-197627705 GGTCCGAGCGGAGCGGGCGCCGG - Intergenic
968576663 4:1369356-1369378 GGCCCCAGGAGTGCCGGAGGCGG + Intronic
968620831 4:1602820-1602842 GGTCTGAGGGCAGCAGGAGCCGG + Intergenic
969036209 4:4255943-4255965 ACTCCCAGGGGAGCAGCAGCAGG + Intergenic
969488522 4:7485764-7485786 GGGCCCAGGGGAGCCCGATGAGG + Intronic
970491822 4:16582797-16582819 GGTCCCAGTGGAGCTGTGGCTGG - Intronic
970664307 4:18319337-18319359 GGTGCTGGGGGAGCAGGAGCGGG + Intergenic
972847872 4:43011339-43011361 GGTCAGAGGGAAGCTGGAGCAGG + Intronic
975735165 4:77373555-77373577 AGTCCCAGGGCAGCAGGAGGAGG + Intronic
975736901 4:77389707-77389729 GGTTCCAGGGCAGCAGGAGGAGG + Intronic
984727762 4:183037723-183037745 GGACCCAGGGGAGCCAAAGCCGG - Intergenic
984973441 4:185209975-185209997 GGGCCCCGGGCGGCCGGAGCTGG + Intronic
985111898 4:186555153-186555175 TGGCCCAGGGGAGGCGGCGCGGG + Intronic
985497622 5:218493-218515 GGTCCGAGCGGAGCGGGCGCCGG + Intronic
985544783 5:504229-504251 GTTCCCGGGGGTTCCGGAGCTGG - Intronic
985832183 5:2242022-2242044 GGTCCCCGGGGAGCCAGGGCAGG - Intergenic
986897874 5:12392821-12392843 GGTCCCAGGAGACCTGGAGTAGG - Intergenic
987007128 5:13722236-13722258 GATCAAAGGGGAGCCAGAGCTGG + Intronic
989229908 5:39074204-39074226 GGAGCCAGGGCAGCCGCAGCTGG - Intronic
990488449 5:56281136-56281158 GGGCCCACTGGAGCAGGAGCTGG - Intergenic
992663547 5:78984720-78984742 GGTCCGCGGGGCGCCAGAGCCGG + Intronic
994082144 5:95718867-95718889 GGTCCCAGGAGAGCACAAGCAGG + Intronic
996858953 5:128042914-128042936 GGACCCAGAGGAGCCAGGGCAGG + Intergenic
996881422 5:128300890-128300912 GGTACCAGGAGAGCAAGAGCCGG + Exonic
997228716 5:132228025-132228047 GGCCTCGCGGGAGCCGGAGCCGG + Intronic
997303977 5:132825376-132825398 GGGCCCAGGGAGGCCAGAGCTGG + Exonic
998406261 5:141876348-141876370 GGTCCCCCGCAAGCCGGAGCCGG + Intronic
999636607 5:153629485-153629507 GGTTTCAGGGGAGCAGGAGAAGG - Intronic
1000041212 5:157486480-157486502 AGTCCCAGGGGTGCAGGTGCAGG + Intronic
1000082231 5:157859000-157859022 GGTCCGTGGGGAGCAGGAGAGGG - Exonic
1000343919 5:160298511-160298533 AGGCCCAGGGGAGCAGGCGCTGG - Intronic
1001193818 5:169653892-169653914 GATCCCTGGGGTGCCTGAGCTGG + Intronic
1001406528 5:171481003-171481025 GGTCCCAGTGGAGCCCCAGGTGG - Intergenic
1001523577 5:172413125-172413147 AGTCCCAGCGGAGCCGGAGCAGG + Intronic
1001960762 5:175879151-175879173 GGATCCAGGGGAGCCCCAGCAGG - Intronic
1002021916 5:176368892-176368914 GGGCCCAGGGCAGCCGCAGTCGG - Exonic
1002303895 5:178272505-178272527 GGTCCCAGGAGAGTGGGAGTGGG + Intronic
1002608105 5:180395323-180395345 TGTCCCAGGGGAGTCAGAGAGGG + Intergenic
1003921603 6:10838294-10838316 GGTCCCCGGAGGGGCGGAGCGGG - Intronic
1005314997 6:24596040-24596062 GGTGCCAGCGGAGACGCAGCAGG - Exonic
1006029797 6:31170539-31170561 TGGGCCAGGGGGGCCGGAGCCGG - Exonic
1006787555 6:36678739-36678761 GTTCCTTGTGGAGCCGGAGCTGG + Exonic
1006918644 6:37613335-37613357 GGGCCCAGGGGAGTCAGAGAGGG - Intergenic
1007357390 6:41331656-41331678 GGACAGAGGGGAGCCGGAGCTGG + Intergenic
1008649021 6:53544797-53544819 CGCCGCCGGGGAGCCGGAGCGGG - Exonic
1009413418 6:63392388-63392410 GGTCCCTTTGGAGCTGGAGCTGG - Intergenic
1014137748 6:117907949-117907971 GGACGGAGGGGACCCGGAGCCGG - Intronic
1015928704 6:138335124-138335146 GCTCCCGGTGGAGCCTGAGCGGG - Exonic
1016386771 6:143537101-143537123 GGTCCCCGGGAAGCCAGCGCAGG - Intronic
1018559730 6:165089171-165089193 AGTCCCAGGGCACCAGGAGCAGG - Intergenic
1019337554 7:492483-492505 TGGCACAGGGGAACCGGAGCAGG - Intergenic
1019359837 7:599032-599054 GGACCCAGGGAAGCTGGACCAGG + Intronic
1019370415 7:660227-660249 TGTCCCCGGGGAGACTGAGCAGG - Intronic
1019443829 7:1060782-1060804 AGTCCCTCTGGAGCCGGAGCTGG + Intronic
1019514485 7:1433734-1433756 GGTCCCAGCAGGGCCAGAGCAGG - Intronic
1019523850 7:1472069-1472091 GGGCCCAGGGGAGCTGGAGGTGG - Intronic
1019578837 7:1750262-1750284 GCTCCCCGGGGGGCCGGGGCCGG - Intergenic
1019626940 7:2020586-2020608 GGTACCAGGGCAGCCCGGGCAGG - Intronic
1019910831 7:4099780-4099802 GGCCCAAGGGGAGCCGCAGCTGG + Intronic
1020093051 7:5352125-5352147 AGTCACAGGGCAGCAGGAGCTGG + Intronic
1020111665 7:5451265-5451287 GGACCCAGAGGAGCTGGAGGGGG - Intronic
1020140768 7:5610507-5610529 GGTCCCAAGGGAGCCGAAATGGG - Intergenic
1020280937 7:6649677-6649699 AGTCCCTGGGGAGTCTGAGCGGG - Intronic
1020617341 7:10476403-10476425 CGGCCCAGGGGTGCTGGAGCCGG - Intergenic
1022097093 7:27147910-27147932 GGTCCCCGGGGAGCGGGCTCCGG - Intronic
1022100111 7:27164476-27164498 GCAGCCAGGGCAGCCGGAGCTGG - Intronic
1022493301 7:30837219-30837241 GGTCACAGGGGACCAGGAGCAGG + Intronic
1023664914 7:42513056-42513078 GGTCAAAGGGAAGCAGGAGCTGG - Intergenic
1024258767 7:47558727-47558749 GGACCCTGGGGAGGCAGAGCTGG - Intronic
1024588435 7:50860635-50860657 GGTCTCAGGGGAGTCAGTGCAGG - Intergenic
1025695474 7:63772270-63772292 GGCCACCGGGAAGCCGGAGCTGG + Intergenic
1027926776 7:84475100-84475122 GGTCCCAGGAGTGCAGGGGCTGG + Intronic
1028675725 7:93458481-93458503 GGGCCCAGGGCAGTGGGAGCAGG - Intronic
1029570025 7:101363151-101363173 GCTGCCAGGGGAGCCGGCGCCGG - Exonic
1029927091 7:104329256-104329278 GGACCCCGGGGCGCCCGAGCCGG + Intronic
1031528539 7:122850244-122850266 GCCCCCAGTGGAGCAGGAGCTGG - Intronic
1032074860 7:128831482-128831504 GGGCCGAGGGGAGCTGGCGCGGG + Intronic
1033560667 7:142527544-142527566 GATCCCATGGGAGACTGAGCAGG - Intergenic
1034938145 7:155212832-155212854 GGGGCCAGGGGAGCCGGAGAGGG + Intergenic
1035202417 7:157276103-157276125 GGTCCCAGGGGCCCCTGAGTAGG - Intergenic
1035253547 7:157612604-157612626 GCTGCCAGGGGAGCCGCAGAAGG + Intronic
1035264992 7:157685480-157685502 CTTCCTCGGGGAGCCGGAGCCGG - Intronic
1035282798 7:157787951-157787973 GTTCCCAGGGGACCCGGTGCTGG - Intronic
1035340522 7:158157774-158157796 TCTCCCAGGGGAGCAGGCGCAGG - Intronic
1035828336 8:2668330-2668352 GGTCCCAGAGGACCGGGAGCAGG + Intergenic
1036708021 8:11059587-11059609 GGTGCCAGTGGAGGAGGAGCAGG + Intronic
1037803977 8:22049304-22049326 GGTCCCCGCGGGGCCGGGGCGGG + Intronic
1039798669 8:40936155-40936177 GACCCCAGGGGAGTGGGAGCAGG + Intergenic
1040676621 8:49757879-49757901 GGTCCCAGGGGAGCCAGTCTGGG - Intergenic
1043282702 8:78488210-78488232 TGTCCCAGGTGGGACGGAGCAGG + Intergenic
1046722408 8:117635607-117635629 GGTCAGAGGGGAGCCTGAGAGGG + Intergenic
1047731887 8:127735281-127735303 GGCCCCACGGAAGCCTGAGCAGG + Intergenic
1049258764 8:141627701-141627723 GGTCCCAGGGAGGCCGGAGCGGG - Intergenic
1049462631 8:142737172-142737194 GGAACCAGGAGGGCCGGAGCAGG - Intergenic
1049531952 8:143159439-143159461 GGTCGCAGGGGTCCCGGAGGGGG + Intronic
1049872840 8:144994495-144994517 GAACTCAGGGGAGCTGGAGCTGG - Intergenic
1049896088 9:113383-113405 GGTCCAAGGGGCGCGGGGGCCGG - Intergenic
1053239716 9:36486733-36486755 GTGCCCTGGGGAGCCGCAGCGGG - Intronic
1056814312 9:89790464-89790486 GCTCCCTGGGGAGTCGGGGCAGG + Intergenic
1058703441 9:107619846-107619868 GGCCACAGGTGAGCCTGAGCGGG + Intergenic
1059308796 9:113374400-113374422 GGTCCCAGGGGAAGCTGAGCTGG + Exonic
1059414729 9:114155797-114155819 GCGCCCAGGGGCGCCCGAGCAGG - Exonic
1059495425 9:114705210-114705232 GGTCCCAGAGCAGGCAGAGCTGG - Intergenic
1060484969 9:124041066-124041088 GGTCCCGGGGGAGCCGGCCCGGG + Intergenic
1061324214 9:129852967-129852989 GGGCTCAGGGAAGCCTGAGCAGG + Intronic
1061678452 9:132231132-132231154 GGTCCCAGGGGAGTCGGACCAGG + Intronic
1061720635 9:132548953-132548975 GGGCCCAGGAGACCCGAAGCAGG - Intronic
1061866471 9:133494056-133494078 GGACACAGGAGAGCCGGGGCAGG + Intergenic
1062004486 9:134232327-134232349 GGGCCCGGGGGAGCAGGAGGGGG - Intergenic
1062152837 9:135030746-135030768 GCTCCCAGGAGAGCCGCAGAGGG - Intergenic
1062190822 9:135247024-135247046 GGACTCAGGGGGGCCGGGGCTGG - Intergenic
1062341238 9:136094811-136094833 GGTCCCTGGGGAGGCCGCGCGGG + Intronic
1062478596 9:136741449-136741471 GGTCCCACGGGAGCAGGGGCGGG - Intronic
1062718822 9:138024197-138024219 GGCCCAAGGGAAGCCTGAGCAGG + Intronic
1202799631 9_KI270719v1_random:163490-163512 TGGCCCAGGGGTGCTGGAGCCGG + Intergenic
1185432067 X:17276-17298 GGTCCCAAGGGAGCAGGAAAGGG - Intergenic
1185441383 X:229990-230012 GGTCCCAAGGGAGCAGGAAAGGG - Intergenic
1186466472 X:9787091-9787113 GGTCCAAGGGGTGCCGAACCAGG - Intronic
1187064813 X:15823097-15823119 GGGGCCGGGGCAGCCGGAGCCGG + Exonic
1187900884 X:24025687-24025709 GGCGCCACGGGAGCGGGAGCGGG + Intronic
1192798724 X:74446127-74446149 GGTCCCAGGGGAAGAGGAGGGGG - Intronic
1200111486 X:153743141-153743163 GGGCTCAGTGGAGCCTGAGCCGG + Intronic
1200150661 X:153949878-153949900 AGCCCCAGGGGAGCTGGAGCAGG + Intronic