ID: 946305028

View in Genome Browser
Species Human (GRCh38)
Location 2:218851567-218851589
Sequence CCAGTAAGGGACACTCTAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946305021_946305028 -8 Left 946305021 2:218851552-218851574 CCTGGCCATTTCAACCCAGTAAG No data
Right 946305028 2:218851567-218851589 CCAGTAAGGGACACTCTAATGGG No data
946305017_946305028 30 Left 946305017 2:218851514-218851536 CCACATAGCTGGTGACAGAGTGA No data
Right 946305028 2:218851567-218851589 CCAGTAAGGGACACTCTAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946305028 Original CRISPR CCAGTAAGGGACACTCTAAT GGG Intergenic
No off target data available for this crispr