ID: 946307260

View in Genome Browser
Species Human (GRCh38)
Location 2:218863230-218863252
Sequence CAGGCTGTTCCCCGATGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 241}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946307258_946307260 -9 Left 946307258 2:218863216-218863238 CCAGTAAGGGCTTCCAGGCTGTT 0: 1
1: 0
2: 3
3: 22
4: 471
Right 946307260 2:218863230-218863252 CAGGCTGTTCCCCGATGCCCAGG 0: 1
1: 0
2: 0
3: 19
4: 241
946307251_946307260 20 Left 946307251 2:218863187-218863209 CCCCAGTCTCACTTCAGCTGGCA 0: 1
1: 0
2: 2
3: 19
4: 201
Right 946307260 2:218863230-218863252 CAGGCTGTTCCCCGATGCCCAGG 0: 1
1: 0
2: 0
3: 19
4: 241
946307249_946307260 27 Left 946307249 2:218863180-218863202 CCTAAATCCCCAGTCTCACTTCA 0: 1
1: 1
2: 1
3: 26
4: 281
Right 946307260 2:218863230-218863252 CAGGCTGTTCCCCGATGCCCAGG 0: 1
1: 0
2: 0
3: 19
4: 241
946307257_946307260 -8 Left 946307257 2:218863215-218863237 CCCAGTAAGGGCTTCCAGGCTGT 0: 1
1: 0
2: 3
3: 33
4: 518
Right 946307260 2:218863230-218863252 CAGGCTGTTCCCCGATGCCCAGG 0: 1
1: 0
2: 0
3: 19
4: 241
946307253_946307260 18 Left 946307253 2:218863189-218863211 CCAGTCTCACTTCAGCTGGCAGC 0: 1
1: 0
2: 1
3: 25
4: 198
Right 946307260 2:218863230-218863252 CAGGCTGTTCCCCGATGCCCAGG 0: 1
1: 0
2: 0
3: 19
4: 241
946307248_946307260 28 Left 946307248 2:218863179-218863201 CCCTAAATCCCCAGTCTCACTTC 0: 1
1: 0
2: 3
3: 13
4: 222
Right 946307260 2:218863230-218863252 CAGGCTGTTCCCCGATGCCCAGG 0: 1
1: 0
2: 0
3: 19
4: 241
946307247_946307260 29 Left 946307247 2:218863178-218863200 CCCCTAAATCCCCAGTCTCACTT 0: 1
1: 0
2: 0
3: 28
4: 198
Right 946307260 2:218863230-218863252 CAGGCTGTTCCCCGATGCCCAGG 0: 1
1: 0
2: 0
3: 19
4: 241
946307252_946307260 19 Left 946307252 2:218863188-218863210 CCCAGTCTCACTTCAGCTGGCAG 0: 1
1: 0
2: 4
3: 10
4: 187
Right 946307260 2:218863230-218863252 CAGGCTGTTCCCCGATGCCCAGG 0: 1
1: 0
2: 0
3: 19
4: 241

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946307260 Original CRISPR CAGGCTGTTCCCCGATGCCC AGG Intronic
902886453 1:19408194-19408216 GAGGCTGTGCCCTGATGCCCTGG - Intronic
904523652 1:31115390-31115412 CAGGATGATCGCTGATGCCCGGG - Intergenic
905233464 1:36529851-36529873 GTGGCTGCTCCCCCATGCCCTGG + Intergenic
905694507 1:39965043-39965065 CAGCCTCTTCCCAGAGGCCCAGG + Intronic
909736215 1:78966187-78966209 CAGGCTCTTCCCCGCTGCAAAGG - Intronic
911588877 1:99723303-99723325 CAGGCTGTTCTCCAACTCCCCGG - Intronic
912366266 1:109136373-109136395 CTGGCTGTCCCCCGAAGCCAGGG + Intronic
915456471 1:156044053-156044075 CTGGCTGGTCCCCGATCCTCCGG + Exonic
915473058 1:156137180-156137202 CAGGCTGTTCCCGCAGCCCCAGG - Exonic
917468686 1:175307547-175307569 CAGGCTGTTCCCCCAATCCCAGG + Intergenic
918103665 1:181398163-181398185 CAGGCTCTACCCAGATGCCTTGG + Intergenic
918344846 1:183598056-183598078 CATGCTGTGCCCTGAGGCCCCGG + Intronic
920676696 1:208043078-208043100 CGGGGTGGTCCTCGATGCCCGGG + Exonic
921922988 1:220689557-220689579 CAGGCTGTTCCCCAACTCCTGGG + Intergenic
922824848 1:228510587-228510609 CAGGCTGTTTCCCCAAGTCCTGG - Intergenic
924144969 1:241064373-241064395 CAGGCTGTTCTCCAATTCCTGGG - Intronic
1063515278 10:6688942-6688964 AAGGCTTTTTCCCGCTGCCCTGG - Intergenic
1064946330 10:20794038-20794060 CAGGCTGCTTCCCGAGGCCCAGG - Intronic
1065065160 10:21955127-21955149 GGGGCTGTTCCCCCCTGCCCAGG - Intronic
1065508882 10:26457620-26457642 CAGCCTGTTCCCAGGTCCCCTGG - Intronic
1065883561 10:30058632-30058654 CAGGGTTTGCCTCGATGCCCTGG - Intronic
1067295851 10:44974902-44974924 CAGATTGTTCCCCGTTGCTCAGG - Intronic
1069867218 10:71511374-71511396 CAGGCTGGGCCCCGATTCCCAGG - Intronic
1069933101 10:71896794-71896816 CAGGCTGATCCCCGACTCCTCGG + Intergenic
1069954963 10:72044446-72044468 CAGCCTCTTCCCAAATGCCCTGG + Intergenic
1072428041 10:95346999-95347021 CCCTCTGTTCCCAGATGCCCAGG + Intronic
1073287266 10:102396462-102396484 TAGGCTGTTCCACGATCACCAGG - Exonic
1073307133 10:102511920-102511942 CAGGCTGGTCTCAGATGCCTGGG + Intronic
1073464630 10:103687207-103687229 CAGGCTGGACCCCCAGGCCCAGG - Intronic
1075787157 10:125057831-125057853 CAGTCTGTTGCCCGAAGCACTGG - Intronic
1076653519 10:132006159-132006181 CAGGCTGTACCCCGACAACCTGG - Intergenic
1076744964 10:132508280-132508302 CTGGCTGGTCCCCAGTGCCCTGG - Intergenic
1076905215 10:133357886-133357908 CGGGGTGCTCCCCGAGGCCCCGG + Intronic
1076921339 10:133456150-133456172 CAGGCCGTTCCCTGCTGCCGCGG + Intergenic
1077391920 11:2304212-2304234 CATTGTGTTCCCAGATGCCCAGG + Intronic
1078132304 11:8622805-8622827 AAGGCTGTTACCTGATGCTCTGG + Exonic
1078594183 11:12672964-12672986 CAGGCTGGTCTCAGACGCCCGGG - Intergenic
1080233428 11:30043369-30043391 CAGACTCTTCCCTGCTGCCCTGG + Intergenic
1084042858 11:66552528-66552550 CAGGCTGATCTCCAATTCCCGGG - Intronic
1084273231 11:68039789-68039811 CAGGTTGTTCCCCCACCCCCTGG + Intronic
1084376200 11:68779566-68779588 CAGGCAGATCCCCTGTGCCCAGG + Intronic
1084548232 11:69825173-69825195 CAGGCTGTTCTCAGGTGGCCAGG + Intergenic
1084707680 11:70824774-70824796 CAGGCAGTTCCCGGATCACCCGG - Intronic
1085224706 11:74908989-74909011 CAGGCTGCTCCACGGTGCTCAGG + Intronic
1089620007 11:119716752-119716774 CAGGCTGTGCCCCCAACCCCAGG + Intronic
1091840801 12:3619276-3619298 CAAGCTGCTCTCCGAGGCCCCGG + Exonic
1092032042 12:5294429-5294451 CAGGCTGTCCCCCGGGGTCCGGG + Intergenic
1094509611 12:31088346-31088368 ACAGCTGTTCCTCGATGCCCTGG - Intronic
1095121978 12:38430221-38430243 CAGGCTGTTCACAGGTTCCCAGG - Intergenic
1096435396 12:51586620-51586642 CAGGCTGTTCTCAAATGCCTGGG - Intergenic
1098296442 12:69008910-69008932 CAGGCTGGTCCCAGATTCCCAGG - Intergenic
1099687988 12:85913725-85913747 GAGGCTGTTCCCCAAGCCCCAGG + Intergenic
1101874837 12:108591354-108591376 AATGCTGGTCCCCGGTGCCCCGG - Exonic
1102681300 12:114692419-114692441 CAGGCGGTTCGCCGGTTCCCGGG - Intergenic
1103588078 12:121971027-121971049 CAGGCTGTTCTCAGAGGACCAGG + Intronic
1103746292 12:123126678-123126700 CAGGCTGTTCTCGGAGGCCACGG - Intronic
1104743583 12:131196023-131196045 CAGGGTGTTCCCCTCTGCCTGGG + Intergenic
1104898645 12:132176222-132176244 GAGGCTCTTCCCCGACGCCACGG + Intergenic
1105526277 13:21180693-21180715 CAGGCTGGTCCCCAATTCCTGGG + Intergenic
1106400772 13:29428344-29428366 CAGGCAGTGCCCTGAAGCCCAGG + Intronic
1109433777 13:62272286-62272308 CAGGCTGTGCCCTGACGACCTGG - Intergenic
1112342615 13:98565264-98565286 CAGGCTCTGCCCTGCTGCCCTGG - Intronic
1113043245 13:106126926-106126948 CAGGCTCTTCCTGGTTGCCCGGG - Intergenic
1113876629 13:113598633-113598655 CAGGCTGTCCCCTGAGGACCTGG + Intronic
1114458723 14:22873414-22873436 CAGTCTGTTCCTTGCTGCCCAGG - Exonic
1117393512 14:55285398-55285420 CATGCTGTTCCTCGACTCCCAGG - Intronic
1118220877 14:63853486-63853508 GAGGCTGTGCCCGGGTGCCCCGG + Intronic
1121154505 14:91670465-91670487 CAGGCTGTTCTCAAATGCCTAGG - Intronic
1121526622 14:94623871-94623893 CAGGCTGTGCCCAGAGACCCAGG - Exonic
1122023618 14:98859109-98859131 CAGGCTGTTCCTCTGGGCCCGGG - Intergenic
1122266476 14:100549176-100549198 CGGGCTGTTCCCTGGGGCCCCGG + Intronic
1123631540 15:22263644-22263666 CAGGCGGTTCCCAGCTGCCCAGG - Intergenic
1125072475 15:35572370-35572392 CAGGCAGCTCCCAGATTCCCTGG + Intergenic
1125501923 15:40245257-40245279 TAGGCTGGTCCCCGCTGCACTGG - Intronic
1127836987 15:62797906-62797928 CAGGCTCTGCCCCGACTCCCTGG - Intronic
1129276655 15:74449988-74450010 CAGGCAGTGCCCCAATGCCTGGG - Exonic
1130124620 15:81082722-81082744 CAGGCTGTTCTCAAATGCCTGGG + Intronic
1133115545 16:3576204-3576226 CAGGGTCTTCCCCTATGGCCAGG - Intronic
1133224347 16:4333480-4333502 GAGGCAGGTCCCCGTTGCCCTGG - Exonic
1137300895 16:47146440-47146462 CAGTCTGTTCCCAGATTACCTGG + Intergenic
1137489554 16:48920205-48920227 CAGGCTTTTCCCCGACACCAAGG + Intergenic
1138195682 16:55050376-55050398 CAGGCTCTTCCCCTACTCCCTGG - Intergenic
1138489801 16:57370172-57370194 CAGGCTGGTCTCAGATTCCCGGG + Intergenic
1139249094 16:65477624-65477646 GAGGCTGTTCCCCCTTGCCTAGG + Intergenic
1140356024 16:74307494-74307516 CTGGCTCTCCCCCGATGCCTGGG - Intergenic
1141971460 16:87486802-87486824 CAGGCGGTTCCCAGCTGCCCAGG + Intronic
1142058640 16:88015892-88015914 GAGGCTGTTTCCCGCGGCCCCGG + Intronic
1143585143 17:7847186-7847208 CCGGCTGCTCCCCCAGGCCCAGG + Exonic
1144328281 17:14202753-14202775 CAGCCTGTTCCCCCCTGCGCTGG + Intronic
1144673329 17:17145402-17145424 CAGGCTGTTCCTCAGGGCCCAGG + Intronic
1145929613 17:28675638-28675660 CAGACTGCTCCCGGAAGCCCTGG + Intronic
1146127253 17:30238984-30239006 CAGCCTCTTCCCAGCTGCCCAGG - Intergenic
1147452925 17:40517224-40517246 CAGGATGTGGACCGATGCCCAGG - Intergenic
1147738240 17:42654541-42654563 CAGGCTGTTCCACTGTGCCCAGG + Intergenic
1148903881 17:50899288-50899310 CAGGCTCTTCCCCTGTGCCCTGG - Intergenic
1149666635 17:58369434-58369456 CAGGCTGTTTCCTTGTGCCCAGG + Intronic
1150373398 17:64661507-64661529 GGGGCTGTTCCCCGAGCCCCGGG + Intronic
1150778820 17:68102260-68102282 GGGGCTGTTCCCCGAGCCCCGGG - Intergenic
1151744408 17:76004107-76004129 CAGGCTGTTCCCTACTGCCTGGG + Intronic
1151883653 17:76910784-76910806 AGGGCTGTGCTCCGATGCCCTGG + Intronic
1152195936 17:78918409-78918431 CAGCCTGTGCCCTGACGCCCTGG - Intronic
1153107203 18:1541529-1541551 CACCCTGTTCCCTGTTGCCCAGG + Intergenic
1153630163 18:7061864-7061886 CAGGCTGTTCTCAGACGCACAGG - Intronic
1156025930 18:32655267-32655289 CAGCAAGTTCCCCCATGCCCTGG + Intergenic
1157280916 18:46345797-46345819 CAGGCTGTGCCCCGACTCCCGGG + Intronic
1160223342 18:76992854-76992876 TGGGCTGTGCCCCTATGCCCTGG + Intronic
1161029825 19:2052325-2052347 CAGGCTTCCCCCCAATGCCCCGG - Intergenic
1161114898 19:2491197-2491219 CAGGCCCTTCCCGGAAGCCCGGG + Intergenic
1163308534 19:16497902-16497924 CAGGCTGTTCTCAGATTCCTGGG - Intronic
1163585298 19:18160666-18160688 CAGGCTGAGCCTGGATGCCCTGG + Intronic
1165299150 19:34957208-34957230 CATGCTGTTCCCACATGCACTGG + Exonic
1166296936 19:41893992-41894014 AGGGCTGTTACCCAATGCCCAGG - Intronic
1168298886 19:55391999-55392021 CAGGCTGTTTGGCGCTGCCCAGG + Intronic
1168650245 19:58087848-58087870 CAGGCTGGTCTCGAATGCCCGGG + Intronic
925165578 2:1713709-1713731 CAGTCTGTGCCCCCATGCTCCGG - Intronic
925347220 2:3179655-3179677 GGGGCTGATGCCCGATGCCCTGG + Intergenic
925949755 2:8899363-8899385 CAGGCTGTTCCAGGATTCCTCGG + Intronic
928282091 2:29956707-29956729 CAGGCTGTTCTCAAATGCCTTGG + Intergenic
930198602 2:48531639-48531661 CAGGCTGCTCCCGGCTGCTCTGG - Intronic
930363260 2:50408458-50408480 CAGACTGTTCCACCAAGCCCTGG - Intronic
931741490 2:65249715-65249737 CAGGATGTTCCCAGCTGACCTGG + Intronic
938144460 2:128822070-128822092 CAGCCTGTTTCCCGCTTCCCTGG - Intergenic
938149692 2:128871457-128871479 CAGCCTGCTCCCCGAACCCCGGG - Intergenic
942947452 2:181685163-181685185 CAAGCTGTTCCTCGATCCCCGGG - Intergenic
943585287 2:189731910-189731932 CAGGCTGTTCTCGAATGCCTGGG + Intronic
946307260 2:218863230-218863252 CAGGCTGTTCCCCGATGCCCAGG + Intronic
1168826875 20:819872-819894 CAGGCTGTAACCCGCAGCCCCGG - Intergenic
1169142464 20:3234101-3234123 CATGCTCTTCACCGATGCCGGGG - Exonic
1171256106 20:23690172-23690194 CTGGCTGTTCCCCGCTGCCTGGG - Intergenic
1171263456 20:23752082-23752104 CTGGCTGTTCCCCACTGCCTGGG - Intergenic
1171272509 20:23827854-23827876 CTGGCTGTTCCCCAATGCCTGGG - Intergenic
1171324604 20:24280492-24280514 CAGGCAGCTCCGGGATGCCCAGG - Intergenic
1172197235 20:33100287-33100309 CAGGTTGTTCCCCGAGGCCTGGG - Intronic
1172400607 20:34648037-34648059 CAGGCTGTTCTCAAATGCCTAGG - Intronic
1173425718 20:42941727-42941749 CAGGCTGTTCTTAGATGCCCAGG + Intronic
1173743144 20:45416527-45416549 CAGGCTCTTTCCCAAAGCCCTGG + Exonic
1173984104 20:47247754-47247776 CCAGCTGATCCCCCATGCCCCGG - Intronic
1174012860 20:47464567-47464589 CAGGCTGTACCCAGATGCAAAGG - Intergenic
1174018683 20:47511191-47511213 CATGCTGTACCCTGATGGCCTGG - Intronic
1174802134 20:53573332-53573354 CAGGCTGTTTCCCAAAGTCCTGG + Intronic
1175424054 20:58853322-58853344 CGGGCTGTTCCCCGATTTCAGGG - Exonic
1175810995 20:61857143-61857165 CAGGCTGTCACCCTCTGCCCCGG - Intronic
1176217932 20:63957042-63957064 CAGGCGGCTCCCCCAGGCCCGGG - Exonic
1176310508 21:5146538-5146560 CAGGCTGTTCCCGTGTGGCCTGG - Intronic
1178989040 21:37336377-37336399 CAGGCTGGTCTCCAATGCCTGGG + Intergenic
1179577812 21:42318562-42318584 CAGTCTGCTCCCCCATGCCGGGG + Intergenic
1179846547 21:44115497-44115519 CAGGCTGTTCCCGTGTGGCCTGG + Intronic
1180559462 22:16602876-16602898 CAGGCCGTTCCCCGAAGCTGGGG - Intergenic
1180843136 22:18968466-18968488 CCGGCTGTTCCCAGCTGCTCTGG - Intergenic
1180930634 22:19588365-19588387 CAGGGTGTTCCCCTTTCCCCGGG + Intergenic
1181048221 22:20226613-20226635 CAGGCTGGTCCCAGGTCCCCAGG + Intergenic
1181428266 22:22857891-22857913 CAGGCTGTTCCCTGGTGCTGTGG - Intronic
1181567253 22:23746616-23746638 TAGGCTCTTGCCCGTTGCCCAGG + Intronic
1181604381 22:23971512-23971534 CAGCCAGTTCACAGATGCCCTGG + Exonic
1182158881 22:28101912-28101934 CAGGATGTTCCAGGATGCCTCGG + Intronic
1182781180 22:32869174-32869196 CAAGCTGTGGCCGGATGCCCTGG - Intronic
1182874811 22:33682423-33682445 CAGGCTGTTCCCTGTCACCCAGG + Intronic
1183113164 22:35668299-35668321 CACGCTGTTCCCCGACCACCTGG + Exonic
1183385161 22:37510064-37510086 CAGCCTGTGCCCAGAAGCCCTGG + Intronic
1184187718 22:42875997-42876019 CAGGCCCTTCCCCAGTGCCCTGG - Intronic
1184693208 22:46126712-46126734 CAGGCTGCTCCTCCCTGCCCAGG + Intergenic
951614953 3:24532068-24532090 CAGGCTGATCTCCAATGCCTGGG - Intergenic
954251598 3:49371847-49371869 CTGGTTGTTCCAAGATGCCCAGG + Intronic
954911314 3:54113165-54113187 CAGGCTGTTCTCCAATTCCTGGG + Intergenic
957801026 3:85081718-85081740 CGGCCTCTTCCTCGATGCCCTGG - Intronic
960756440 3:121019098-121019120 CAGGCTTTTCCCCACTTCCCGGG + Intronic
960786059 3:121373674-121373696 CAGGCTGATCCCTGCTCCCCTGG - Intronic
961391956 3:126557621-126557643 CAGGCTGGTCTCCCATGCCATGG - Intronic
962421368 3:135232019-135232041 GAGGCTGTTCCCAGTTCCCCAGG - Intronic
962815376 3:138992675-138992697 CAGGCTGTTCCCCCTGGCCAGGG + Intergenic
963071288 3:141307494-141307516 CAGGCACTTCGGCGATGCCCGGG + Intergenic
963389662 3:144644104-144644126 CAGGCAGTTCTCCCATGCACAGG - Intergenic
963732399 3:148986596-148986618 CTGGCTGGTCCCCGATCCTCCGG + Intergenic
965866754 3:173214627-173214649 CTGGCTTTTCCCCAATTCCCTGG - Intergenic
966116128 3:176463625-176463647 CAGGTTGATGCCCGATTCCCTGG + Intergenic
967100721 3:186213335-186213357 CAGGCTGAGCCCCAATGCCATGG + Intronic
967945723 3:194802268-194802290 CATGCTGTTTCCTGATCCCCTGG - Intergenic
969602445 4:8184403-8184425 CAGGCTGTTGCTCTGTGCCCCGG + Intronic
969608900 4:8216307-8216329 CAGGCTGTCACCCCATGGCCCGG - Intronic
976705419 4:88014439-88014461 CAGGCTGATCTCGGATTCCCAGG - Intronic
976778023 4:88727761-88727783 CAGGCTCTTCTCCCATGACCTGG + Exonic
982590822 4:157307486-157307508 CAGGCTGTTGCCACATGGCCTGG - Intronic
984749755 4:183260930-183260952 CAGGCTGCTCCCAGATGACATGG - Exonic
985316176 4:188660891-188660913 CAGGCTCTTCACAGTTGCCCAGG + Intergenic
985743627 5:1634298-1634320 CAGGCTGGTCCACGCTGCCCAGG - Intergenic
985743632 5:1634317-1634339 CAAGCTGGTCCACGCTGCCCAGG - Intergenic
985778047 5:1855459-1855481 CAGGATGGTCCCCGGTGTCCTGG - Intergenic
987825435 5:23024944-23024966 CAGGCTGGTCTCCGATTCCTGGG + Intergenic
988464375 5:31474572-31474594 CAGGCTGTTCTCCAATTCCTGGG + Intronic
988735577 5:34017426-34017448 AAGGCTTTTCCCCTTTGCCCAGG + Intronic
989003827 5:36788076-36788098 CAGGAAGTTCCCCGAGCCCCTGG - Intergenic
991310669 5:65237874-65237896 CAGGCTGGTCTCCAATGCCTGGG - Intronic
991317506 5:65325702-65325724 CAGGCTGGTCTCCAATGCCTGGG + Intronic
991901799 5:71468363-71468385 CAGGCTGGTCTCCAATGCCTAGG + Intronic
995189562 5:109306052-109306074 CAGGCTGATCTCAAATGCCCGGG + Intergenic
998040227 5:138946864-138946886 GAGCCTGTTCCTGGATGCCCTGG + Exonic
999307570 5:150530094-150530116 CAGGCTATTTCCTGGTGCCCAGG + Intronic
1000181310 5:158814133-158814155 CAGGCTGGTCTTCAATGCCCGGG - Intronic
1000366761 5:160498915-160498937 CAGGCTGGTCTCGAATGCCCAGG + Intergenic
1002634629 5:180600975-180600997 CAGGGTGTCCCCCCGTGCCCAGG - Intergenic
1003002351 6:2347925-2347947 CAGGCTGGTCTCAGACGCCCGGG - Intergenic
1006017186 6:31091222-31091244 CAGGCTGCTCCCCGCTGCAAAGG - Intergenic
1006657513 6:35608465-35608487 CAGGCTGATCGCTTATGCCCTGG + Intronic
1007597269 6:43059285-43059307 GAGTCTGTTCCCCGCCGCCCAGG - Exonic
1009516080 6:64619833-64619855 CAGGCTGTTTCCCAAGGACCTGG - Intronic
1010205963 6:73322820-73322842 CAGGCTGTTCCTCCACCCCCTGG - Intergenic
1010226278 6:73492597-73492619 CAGGCTGGTCCGGAATGCCCAGG - Intronic
1012973118 6:105752706-105752728 AAGGCTGTTTCCCGACGCACAGG + Intergenic
1013177556 6:107690439-107690461 CCGGCCCTTCCCCGAAGCCCTGG + Intergenic
1016163437 6:140908745-140908767 CTGCCTGTTCCCAGATCCCCTGG + Intergenic
1016210091 6:141521279-141521301 CAGGCTGGTCCCAGATTCCTGGG + Intergenic
1018237258 6:161738670-161738692 GAGGCTGCTCCCCGAAACCCTGG + Intronic
1019390755 7:785536-785558 CGGGCTGTTCCCAGATCTCCTGG + Exonic
1019560702 7:1655289-1655311 CAGGCTGTACCGCGAGGCCCAGG - Intergenic
1020299600 7:6785386-6785408 CAGGCTGATCCCCAACGCCTGGG + Intronic
1022524560 7:31028790-31028812 CAGGCAGCTCCGCGTTGCCCGGG - Intergenic
1027052748 7:75030075-75030097 CAGGCTGTCCCTGGATGCCATGG - Intronic
1028495112 7:91452977-91452999 CAGGCTGTTCCAGGATTCCTTGG + Intergenic
1028861666 7:95658832-95658854 CAGGCTCTTCCCCGCTGCAAAGG - Intergenic
1029234695 7:99104849-99104871 CAGGCTGTTTGCCTATGACCAGG + Intronic
1029599008 7:101553130-101553152 CAGGCTGTGCCCCGGAGCCGTGG + Intronic
1032328229 7:130952011-130952033 CAGGCTCTTCCTGGCTGCCCGGG + Intergenic
1032568540 7:132974391-132974413 AAGACTGTTCCCCAAGGCCCTGG + Intronic
1032840245 7:135707773-135707795 CAGCCTGTTCCCTGATACACAGG + Intronic
1034539010 7:151744254-151744276 CTGGCACTTCCCCGATGCCGTGG - Intronic
1034617774 7:152434941-152434963 CAGGCCGTTCCCCGAAGCTGGGG + Intronic
1038409749 8:27348902-27348924 GAGGCTGTTCTTCTATGCCCTGG + Intronic
1039429690 8:37516119-37516141 CAGGCTGTTCTCCCTTTCCCTGG - Intergenic
1039798258 8:40933399-40933421 CAGGCTCTTCCCTGAGGCCACGG + Intergenic
1039828640 8:41195412-41195434 CAGCCTCTGCCCCGCTGCCCTGG + Intergenic
1041351677 8:56953183-56953205 CAGGAGGTTCACCCATGCCCTGG - Intergenic
1043852698 8:85232829-85232851 TAGGCTGTTCTCAAATGCCCAGG + Intronic
1045451155 8:102327108-102327130 CAGGCTGTTCTCCAACTCCCAGG + Intronic
1047299104 8:123597534-123597556 CCAGCTGTTCCTGGATGCCCTGG - Intergenic
1047451240 8:124966848-124966870 CAGGCTGGTCCCGGACGCCTGGG + Intergenic
1049586162 8:143433304-143433326 CAAGCTGTGCCCCTATTCCCAGG - Intergenic
1050962339 9:11750837-11750859 CAGGCTGGTCCCGAATTCCCAGG + Intergenic
1052541918 9:29822505-29822527 GAGGCTTTTCCATGATGCCCAGG - Intergenic
1053572321 9:39321668-39321690 CAGGCTGTTCCTCGAAGAGCAGG - Intergenic
1054093881 9:60880380-60880402 CAGGCTGTTCCTCGAAGAGCAGG - Intergenic
1054115355 9:61156303-61156325 CAGGCTGTTCCTCGAAGAGCAGG - Intergenic
1054124824 9:61297343-61297365 CAGGCTGTTCCTCGAAGAGCAGG + Intergenic
1054592401 9:67026239-67026261 CAGGCTGTTCCTCGAAGAGCAGG + Intergenic
1055488952 9:76784714-76784736 CAGCCTGTTCACAGATCCCCTGG - Intronic
1057063504 9:92026587-92026609 CAGGCGGCTCCCCCAGGCCCGGG + Intergenic
1057270126 9:93645857-93645879 CATGCTGTTTCCCCACGCCCTGG + Intronic
1059321791 9:113475960-113475982 CACGCTGTTCCCCAAGGTCCAGG + Intronic
1060563436 9:124567552-124567574 CAGGCTGGTCTCCGACTCCCGGG - Intronic
1060663255 9:125416580-125416602 CAGGCCCTTCCCAGATACCCTGG - Intergenic
1062506477 9:136880184-136880206 CAGGCTGGTCTCAGATTCCCGGG + Intronic
1193126296 X:77874191-77874213 CAGGCTGGTCTCCAATGCCTGGG + Intronic
1193283880 X:79688879-79688901 CAGACTGCTCCCCAATGACCTGG - Intergenic
1193312481 X:80024556-80024578 CAGCATGTCCCCAGATGCCCAGG - Intronic
1194219552 X:91174801-91174823 CAGCCTGTTTCCCGAGGCCCTGG + Intergenic
1196489098 X:116246849-116246871 CAGGCTGTCCCAGGATTCCCCGG - Intergenic
1197449467 X:126594138-126594160 CAGTGAGTTCCCCTATGCCCTGG + Intergenic
1198782304 X:140250535-140250557 CAGGCTGCCCCGCGATTCCCAGG + Intergenic
1200055288 X:153456924-153456946 CTGGCTGTTGCCCAAGGCCCCGG - Intronic
1200068097 X:153514548-153514570 CAGCCTGTCCCACCATGCCCTGG - Intergenic
1200556064 Y:4638565-4638587 CAGCCTGTTTCCCGAGGCCCTGG + Intergenic
1201743900 Y:17350591-17350613 CAGGCTGTTCCAGGATTCCTTGG + Intergenic