ID: 946307744

View in Genome Browser
Species Human (GRCh38)
Location 2:218865745-218865767
Sequence GGCCCAGGACAGTCTCCTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 391
Summary {0: 1, 1: 1, 2: 4, 3: 45, 4: 340}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946307738_946307744 -3 Left 946307738 2:218865725-218865747 CCCAATATGGGCGAGCAGAGGGC 0: 1
1: 0
2: 0
3: 2
4: 75
Right 946307744 2:218865745-218865767 GGCCCAGGACAGTCTCCTGGGGG 0: 1
1: 1
2: 4
3: 45
4: 340
946307724_946307744 29 Left 946307724 2:218865693-218865715 CCCTGTCCCACCCTCAGATAGGT 0: 1
1: 0
2: 4
3: 22
4: 184
Right 946307744 2:218865745-218865767 GGCCCAGGACAGTCTCCTGGGGG 0: 1
1: 1
2: 4
3: 45
4: 340
946307728_946307744 19 Left 946307728 2:218865703-218865725 CCCTCAGATAGGTGCTCCCCACC 0: 1
1: 0
2: 0
3: 19
4: 146
Right 946307744 2:218865745-218865767 GGCCCAGGACAGTCTCCTGGGGG 0: 1
1: 1
2: 4
3: 45
4: 340
946307722_946307744 30 Left 946307722 2:218865692-218865714 CCCCTGTCCCACCCTCAGATAGG 0: 1
1: 0
2: 2
3: 30
4: 223
Right 946307744 2:218865745-218865767 GGCCCAGGACAGTCTCCTGGGGG 0: 1
1: 1
2: 4
3: 45
4: 340
946307733_946307744 2 Left 946307733 2:218865720-218865742 CCCACCCCAATATGGGCGAGCAG 0: 1
1: 0
2: 0
3: 5
4: 100
Right 946307744 2:218865745-218865767 GGCCCAGGACAGTCTCCTGGGGG 0: 1
1: 1
2: 4
3: 45
4: 340
946307725_946307744 28 Left 946307725 2:218865694-218865716 CCTGTCCCACCCTCAGATAGGTG 0: 1
1: 0
2: 1
3: 6
4: 138
Right 946307744 2:218865745-218865767 GGCCCAGGACAGTCTCCTGGGGG 0: 1
1: 1
2: 4
3: 45
4: 340
946307732_946307744 3 Left 946307732 2:218865719-218865741 CCCCACCCCAATATGGGCGAGCA 0: 1
1: 0
2: 0
3: 5
4: 60
Right 946307744 2:218865745-218865767 GGCCCAGGACAGTCTCCTGGGGG 0: 1
1: 1
2: 4
3: 45
4: 340
946307739_946307744 -4 Left 946307739 2:218865726-218865748 CCAATATGGGCGAGCAGAGGGCC 0: 1
1: 0
2: 0
3: 0
4: 43
Right 946307744 2:218865745-218865767 GGCCCAGGACAGTCTCCTGGGGG 0: 1
1: 1
2: 4
3: 45
4: 340
946307729_946307744 18 Left 946307729 2:218865704-218865726 CCTCAGATAGGTGCTCCCCACCC 0: 1
1: 0
2: 0
3: 16
4: 181
Right 946307744 2:218865745-218865767 GGCCCAGGACAGTCTCCTGGGGG 0: 1
1: 1
2: 4
3: 45
4: 340
946307734_946307744 1 Left 946307734 2:218865721-218865743 CCACCCCAATATGGGCGAGCAGA 0: 1
1: 0
2: 0
3: 1
4: 87
Right 946307744 2:218865745-218865767 GGCCCAGGACAGTCTCCTGGGGG 0: 1
1: 1
2: 4
3: 45
4: 340
946307736_946307744 -2 Left 946307736 2:218865724-218865746 CCCCAATATGGGCGAGCAGAGGG 0: 1
1: 0
2: 0
3: 3
4: 71
Right 946307744 2:218865745-218865767 GGCCCAGGACAGTCTCCTGGGGG 0: 1
1: 1
2: 4
3: 45
4: 340
946307726_946307744 23 Left 946307726 2:218865699-218865721 CCCACCCTCAGATAGGTGCTCCC 0: 1
1: 0
2: 0
3: 8
4: 127
Right 946307744 2:218865745-218865767 GGCCCAGGACAGTCTCCTGGGGG 0: 1
1: 1
2: 4
3: 45
4: 340
946307727_946307744 22 Left 946307727 2:218865700-218865722 CCACCCTCAGATAGGTGCTCCCC 0: 1
1: 0
2: 0
3: 10
4: 130
Right 946307744 2:218865745-218865767 GGCCCAGGACAGTCTCCTGGGGG 0: 1
1: 1
2: 4
3: 45
4: 340

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946307744 Original CRISPR GGCCCAGGACAGTCTCCTGG GGG Intronic
900031359 1:375263-375285 GGCCCAGGACTGACCCCTGGAGG - Intergenic
900051911 1:603463-603485 GGCCCAGGACTGACCCCTGGAGG - Intergenic
900251838 1:1675016-1675038 GGCCCAGGACAGGCCTGTGGTGG + Intronic
900262245 1:1737872-1737894 GGCCCAGGACAGGCCTGTGGTGG + Intronic
900320274 1:2080075-2080097 GGCCCAGTACAGTCTCCTGGTGG + Intronic
900329762 1:2128171-2128193 GGCCCAGGTCAGTGACCAGGAGG - Intronic
901630543 1:10646041-10646063 GGCACAGGACAGTCACCTCCTGG - Intronic
902552812 1:17229354-17229376 GGCCCTGCACAGGCTGCTGGTGG + Intronic
902558179 1:17259473-17259495 GGCCAAGGAAAGCTTCCTGGAGG + Intronic
903005144 1:20293422-20293444 AGCCCAGGCCAGTGGCCTGGAGG - Intronic
903062784 1:20681832-20681854 GGACAGGGACATTCTCCTGGAGG - Intronic
903135809 1:21308563-21308585 GGCCCTGGACAGCCTCATGAAGG - Intronic
903874621 1:26464963-26464985 GGACCATGACAGTCTCCAGGTGG + Intronic
904699187 1:32348181-32348203 GGGTCAGGAAAGTCTTCTGGAGG - Intergenic
904837130 1:33346269-33346291 ACTCCAGGACAGTCTCCTGAGGG + Intronic
905872840 1:41414977-41414999 GCCCCAGAGCAGTCTCTTGGGGG - Intergenic
905896239 1:41547612-41547634 GGACCAGCACAGACTCCTGCTGG + Intronic
906069776 1:43008069-43008091 CGCCCAGGAAAGTCTTCTGTGGG + Intergenic
906295705 1:44647811-44647833 GGGCAAGGACAGTCTCCTGGGGG - Intronic
909259547 1:73469418-73469440 TGCCCAAGAGAGTCTCTTGGAGG + Intergenic
909433745 1:75616808-75616830 GGCCCAGGATAGTTCCCTTGGGG + Intergenic
913673041 1:121116108-121116130 GGCACAGGACAGTCCTCTGGGGG - Intergenic
914024818 1:143903469-143903491 GGCACAGGACAGTCCTCTGGGGG - Intergenic
914663248 1:149811189-149811211 GGCACAGGACAGTCCTCTGGGGG - Intronic
915129742 1:153688105-153688127 GGCCCTGCAGAGTCACCTGGAGG + Exonic
915286603 1:154857336-154857358 GGCTGAGGAAAGTCTCCTGTGGG - Intronic
918706032 1:187663329-187663351 GGCAAAGGAGAGTGTCCTGGAGG + Intergenic
918755216 1:188331813-188331835 TGCCCAGATCAGTGTCCTGGAGG + Intergenic
918950849 1:191135084-191135106 GGCCCTGGTCAAACTCCTGGAGG - Intergenic
919731700 1:200916946-200916968 GGCCCAGGGAAGCCTGCTGGTGG - Intergenic
919926155 1:202192937-202192959 GGCCCAGGTCAGCCACTTGGTGG + Intergenic
920191744 1:204198232-204198254 GCCCCAGCCCAGTCTCCTTGGGG + Exonic
921075666 1:211698596-211698618 GGCGCAGGATCCTCTCCTGGTGG - Intergenic
921494793 1:215826202-215826224 GGCCCAGGACAGTGGCCTTCTGG + Intronic
921708118 1:218346858-218346880 GGCTCAGGATAGTCTTCTGGGGG - Exonic
921752869 1:218817873-218817895 GGCACAGGACAGCCTGCTGCAGG + Intergenic
922738752 1:228004339-228004361 GGCATAGGGCAGGCTCCTGGGGG - Intergenic
923274901 1:232387253-232387275 GGCACAGGACAGACTCCAGATGG - Intergenic
924644584 1:245866041-245866063 GGCACATGACAGTCTCCAGGGGG - Intronic
1063377056 10:5560821-5560843 GGCCCAGGACCATCCTCTGGGGG - Intergenic
1064762282 10:18633572-18633594 TGAACAGGACAGGCTCCTGGAGG + Intronic
1065623656 10:27609051-27609073 AGCCCAGGTCAGTCTGCTGGAGG + Intergenic
1070283014 10:75063566-75063588 TGTCCTGCACAGTCTCCTGGAGG + Intergenic
1070978197 10:80622619-80622641 GGCCCTGGAGGGTCTCATGGTGG + Intronic
1071013748 10:80970305-80970327 GGGCCTGGACAGCCTCATGGAGG + Intergenic
1071522670 10:86340832-86340854 GGCCCTGGACAAACACCTGGAGG + Intronic
1071524955 10:86353224-86353246 TGACCAGGCCAGTCTCCTGTGGG + Intronic
1071664204 10:87538009-87538031 TGCCCAGGCTGGTCTCCTGGTGG + Intronic
1072405133 10:95144394-95144416 GGCACAGGATTGACTCCTGGTGG - Intergenic
1072719670 10:97772537-97772559 GGGCCAGGATAGTCTAGTGGGGG + Intergenic
1073189772 10:101643071-101643093 GGCTCATGAGAGTCTCCTGTTGG - Intronic
1074055868 10:109922821-109922843 AGCCCAGGGCAGGCTACTGGGGG + Intronic
1075121886 10:119670246-119670268 GGCCCAGGGCACTGTCCTGAGGG - Intronic
1075740704 10:124694341-124694363 GGCCCAGGAGAGTCTATCGGAGG - Intronic
1076416377 10:130292742-130292764 GGCCCAGGACAGGCCCCTCATGG - Intergenic
1076521907 10:131086548-131086570 TGCCCAGGACATTCTCCTGTGGG - Intergenic
1076685779 10:132197883-132197905 GACCCAGGACAACCTCCTGACGG - Intronic
1076735360 10:132456584-132456606 GCCTCAGAACAGCCTCCTGGAGG - Intergenic
1076850822 10:133091876-133091898 GGTCAAGGCCAGCCTCCTGGCGG + Intronic
1077171694 11:1169156-1169178 GCCCAAGGACAGGCTCATGGTGG + Intronic
1077542979 11:3156185-3156207 GGCCGAGGGCACTCTCCCGGGGG - Intronic
1078577794 11:12516440-12516462 GGCTCAGGACAGGCTTGTGGAGG - Intronic
1082095728 11:48127677-48127699 AGCCCAGCAAACTCTCCTGGGGG - Intronic
1082264426 11:50104309-50104331 GGAACAGGACATTTTCCTGGTGG - Intergenic
1082926032 11:58548413-58548435 GGAGGAGGAAAGTCTCCTGGAGG + Intronic
1082992643 11:59221314-59221336 GGCTCAGGACAGTCCGTTGGAGG - Intergenic
1083200507 11:61118527-61118549 GGCCTCGGGCAGTCTCCTCGGGG - Intronic
1083613844 11:64016888-64016910 GGCCCAGGACAGGCTGCAGAGGG + Intronic
1083637740 11:64129509-64129531 CCCCCAGCACAGCCTCCTGGGGG + Intronic
1084328553 11:68416173-68416195 GGACCAGGGCTGTCTCTTGGGGG - Intronic
1084767193 11:71320315-71320337 GGCCCAGGTCATCCCCCTGGTGG + Intergenic
1087762126 11:102111708-102111730 GGTCCACTTCAGTCTCCTGGGGG + Intronic
1088393541 11:109342413-109342435 AGCCCAGGCTAGTCTGCTGGGGG - Intergenic
1089133558 11:116231402-116231424 GGCCAAGGTCAGTGGCCTGGAGG - Intergenic
1090605476 11:128419244-128419266 AGCCCAGGCTAGTCTGCTGGAGG - Intergenic
1090774196 11:129948635-129948657 GGCCCAGGACTTTCCTCTGGAGG + Intronic
1090865725 11:130698893-130698915 GGTCCAGGAAGGCCTCCTGGAGG + Intronic
1090883123 11:130852063-130852085 AGCCCAGGAAGGTCTCCTGAAGG + Intergenic
1091039339 11:132262160-132262182 TGCCCTGGAGAGACTCCTGGGGG - Intronic
1091973976 12:4810377-4810399 GCCCCTGGACATTTTCCTGGAGG + Exonic
1092050806 12:5468731-5468753 GACACAGGACACTCTGCTGGGGG + Intronic
1096123512 12:49103801-49103823 GGCCCAGGACACCCTACGGGAGG + Exonic
1096308124 12:50496891-50496913 GGCCCAGGACGGGCCCCTGATGG + Intergenic
1100173781 12:92006933-92006955 AGCCGAGGACAGGATCCTGGAGG + Intronic
1101037691 12:100721396-100721418 GGGCCAAAACAGTTTCCTGGAGG + Intronic
1101862592 12:108495152-108495174 AGCCCAAGACAGCCTCCAGGGGG - Intergenic
1102282584 12:111630019-111630041 AGCCCAGGTTAGTCTGCTGGTGG - Intergenic
1104546970 12:129721632-129721654 GGTCCAGGACTGCCTGCTGGGGG + Intronic
1105930411 13:25047199-25047221 CGCCCAGGACAGTTTCCCGTCGG - Intergenic
1106196241 13:27496759-27496781 GGGACAGGACAGCCTCCAGGAGG - Intergenic
1106766215 13:32916503-32916525 GACACAGGACAGTCTCCTGGCGG - Intergenic
1107347319 13:39475698-39475720 GGCCCAGGAGAGACTACTGCTGG + Intronic
1107989339 13:45803492-45803514 GGCCAAGGAAGGTCTCATGGAGG + Intronic
1108632658 13:52302052-52302074 GCCCGAGGCCAGTCTGCTGGGGG + Intergenic
1108654041 13:52510541-52510563 GCCCGAGGCCAGTCTGCTGGGGG - Intergenic
1110379971 13:74839211-74839233 TGCCCAGGCTAGTCTGCTGGAGG - Intergenic
1110565973 13:76957816-76957838 GTCCCAGGACAGCATCTTGGAGG - Exonic
1112656110 13:101453897-101453919 GGCCCGGGACAGCCTGCAGGCGG - Exonic
1113217918 13:108063867-108063889 TGCCCAGTCCAGTGTCCTGGAGG - Intergenic
1113635601 13:111916983-111917005 GACCCAGGACAGTCTCAAAGTGG - Intergenic
1113974878 13:114220147-114220169 GGCCCAGGAGGGTCTTCTGAAGG - Intergenic
1114345548 14:21790660-21790682 TCCCCAGGACAGTCTCATAGAGG + Intergenic
1115879755 14:37902096-37902118 CCGCCAGGACAGGCTCCTGGTGG - Intronic
1117722196 14:58638481-58638503 GGCGCAGCGCAGTCGCCTGGAGG + Exonic
1119712962 14:76836302-76836324 GGCACAGTACCATCTCCTGGAGG - Exonic
1120980025 14:90281019-90281041 GGCCAAGGGCAGTCTCCCAGAGG + Intronic
1121180683 14:91926285-91926307 GGCCCAGGGCTGGCTGCTGGAGG + Intronic
1121631001 14:95421936-95421958 GGCCAGGGAGGGTCTCCTGGAGG - Intronic
1121693037 14:95891531-95891553 GGCCCTGGGCAGGCTCCTGAGGG - Intergenic
1122128391 14:99591399-99591421 GCCCCAGGCCAGGCTCTTGGAGG - Intronic
1122548842 14:102539277-102539299 GGGCCAGGAGGGCCTCCTGGGGG + Intergenic
1122595262 14:102885936-102885958 GCCTCAGAACAGTCTGCTGGTGG - Intronic
1122616581 14:103022103-103022125 GGCCAAGGACAGAACCCTGGGGG + Intronic
1122651980 14:103231193-103231215 GGCGCAGGACAGACACCTGGGGG + Intergenic
1122898478 14:104772147-104772169 GGACCAGGCCAGTTTCCTGGTGG + Intronic
1123701572 15:22918140-22918162 AGCTCAGGGCAGTCTTCTGGGGG - Intronic
1124373483 15:29116296-29116318 GGGCCAGGAAAGTGTGCTGGGGG - Intronic
1125968529 15:43893619-43893641 GGCCCAGAAGACTCTCCTGCAGG - Intronic
1127022157 15:54760285-54760307 GGCCCAGGACAGTGGACTGTAGG + Intergenic
1128816265 15:70610968-70610990 GGCACAGGACAGTCTAATGAGGG - Intergenic
1129228814 15:74185090-74185112 GGGTCTGGAGAGTCTCCTGGAGG + Intronic
1130312842 15:82770208-82770230 AGCCCAAGCCAGCCTCCTGGAGG + Intronic
1130913240 15:88285115-88285137 GGCCAAGGACAGTCTCATTCTGG - Intergenic
1131234219 15:90682238-90682260 GAGCCAGGACAGATTCCTGGAGG - Intergenic
1132244277 15:100281817-100281839 GGGACAGGACACTCCCCTGGGGG + Intronic
1132649145 16:1012703-1012725 GGCTCAGGACACCATCCTGGTGG + Intergenic
1132689732 16:1177106-1177128 CGCCCAGGACAGACACCTGAAGG - Intronic
1133002325 16:2857603-2857625 GGACCAGGACCGGCTCCTCGAGG + Intronic
1133201005 16:4204461-4204483 GGGCCCGGGCAGACTCCTGGAGG - Intronic
1135221909 16:20621333-20621355 GGCCCAGGGTAGGGTCCTGGGGG + Intronic
1135939252 16:26806663-26806685 GATCCAGGACAGTCTCCTCTGGG + Intergenic
1136117154 16:28101723-28101745 GACCCGGGACAGGCCCCTGGGGG - Intronic
1136671496 16:31862484-31862506 GGCACAGGACAGTGGCCTGGAGG - Intergenic
1137372582 16:47922127-47922149 AGCCCAGGCTAGTCTGCTGGAGG + Intergenic
1137466209 16:48712178-48712200 GGCCAGGGACAGTGTCCTAGAGG + Intergenic
1138096171 16:54213675-54213697 GGGACAGGACACCCTCCTGGTGG + Intergenic
1139678587 16:68542241-68542263 GGACCAGGACATTCTGCCGGTGG + Intronic
1141663450 16:85453800-85453822 GGCCGAGGTCAGACACCTGGGGG - Intergenic
1142222089 16:88860545-88860567 GCCCCAAGACAGTGTCCTGGTGG - Intronic
1142259922 16:89037908-89037930 GGCAGAGGCCAGGCTCCTGGTGG + Intergenic
1142365290 16:89646866-89646888 GGGGCAGGAAAGGCTCCTGGTGG - Intronic
1142631761 17:1229978-1230000 GGCCCCGGACACCCTCCTGCCGG + Intergenic
1142764241 17:2056664-2056686 TGCCCAGCACACTCTCCTGCGGG - Exonic
1142888727 17:2929388-2929410 CGCCCATCACAGTCACCTGGCGG - Intronic
1143001780 17:3799193-3799215 AGTCCAGGAGAGTTTCCTGGAGG - Intronic
1144050994 17:11497070-11497092 GGCCCAGGACATGGTTCTGGGGG - Intronic
1144745575 17:17612012-17612034 GGCCCAGGCCCGTCTTCTCGAGG + Intergenic
1144860090 17:18296151-18296173 GCCCCAGTAAATTCTCCTGGAGG + Intronic
1145219743 17:21078378-21078400 GGCCCAGGACAGGCCCCTCATGG + Intergenic
1145997821 17:29114658-29114680 GGCCAAGGGTAGCCTCCTGGGGG + Intronic
1146890273 17:36502156-36502178 GGCCAAGGACAGGCTGCCGGGGG - Intronic
1147317899 17:39629556-39629578 GCCCCAGGAAACTCACCTGGTGG - Exonic
1148127669 17:45245254-45245276 GTCCCTGGACAGTGTCCTGGCGG + Exonic
1148192382 17:45688664-45688686 AGCCCAGGAAAGGTTCCTGGAGG - Intergenic
1148219468 17:45851497-45851519 GTTCGAGGACAGCCTCCTGGGGG + Intergenic
1151800958 17:76379467-76379489 GTCCCAGGCCTGTGTCCTGGTGG - Intronic
1152137296 17:78512042-78512064 GGCCCTGGACAGTGTGGTGGGGG + Intronic
1152813051 17:82391222-82391244 AGCCCTGGACAGTCACCTCGAGG + Intronic
1152948294 17:83210450-83210472 GGCCCAGGACTGACCCCTGGAGG + Intergenic
1152992403 18:375333-375355 TGCCTAGGACACTCTCCTGTGGG + Intronic
1155306696 18:24485399-24485421 GTCCCAGGCTAGACTCCTGGAGG + Intergenic
1155573093 18:27216590-27216612 AGCCCAGGCCAGTCTCCTGAAGG - Intergenic
1156361260 18:36386647-36386669 AGCCCATGCCAGGCTCCTGGAGG + Intronic
1156454298 18:37284396-37284418 GGCCCAGGCCAGGCTCCCAGAGG - Intronic
1157114597 18:44851255-44851277 GGCCCAGGAAAGCTTCCTGTAGG + Intronic
1157604782 18:48919295-48919317 GGCCCAGGACAGTATTTGGGAGG + Intergenic
1157622832 18:49026105-49026127 GATCCAGGACAGCTTCCTGGAGG + Intergenic
1160576156 18:79854919-79854941 CGCTGAGGACTGTCTCCTGGAGG - Intergenic
1160820663 19:1056225-1056247 TGCTCAGGACAGTCTCAAGGTGG + Exonic
1160903630 19:1441458-1441480 GGCCCACAACAGCCTCCTGTGGG + Intergenic
1160957036 19:1698579-1698601 GCCCCTGGACAGTGTCCTGAAGG - Intergenic
1160993024 19:1868385-1868407 GGGGCAGGACACCCTCCTGGAGG - Intergenic
1161071453 19:2263829-2263851 GGCCCTGCACAGCCTCCTTGTGG + Intronic
1161952954 19:7477759-7477781 GGCACAGGCCACGCTCCTGGGGG - Intronic
1162283146 19:9716572-9716594 GGCCCAGGACAGGCCCCTCATGG + Intergenic
1162757263 19:12867745-12867767 GTCCGAGGCCAGTTTCCTGGAGG + Exonic
1162911774 19:13851476-13851498 GACCCAGGCCGGGCTCCTGGGGG - Intergenic
1162977408 19:14216477-14216499 GGCCCAGAACAGGATGCTGGGGG + Intergenic
1163632948 19:18426388-18426410 GGACCACGAGAGTCTGCTGGGGG - Intronic
1163678363 19:18666708-18666730 ACCCCAGCACAGCCTCCTGGTGG + Intronic
1163812607 19:19443245-19443267 AGCACAGGACACTCTCCTTGGGG - Intronic
1165059487 19:33198137-33198159 GCCCCAGGACACCCTCCTGCTGG + Intronic
1165253851 19:34560715-34560737 GGCCCTGGAACGTCTTCTGGTGG + Intergenic
1165277525 19:34767814-34767836 GGCCCTGGCCAGTATCCTTGTGG - Intronic
1165771804 19:38384731-38384753 GGTCCAGGGCAGTCTCCCAGTGG + Intronic
1165895824 19:39140282-39140304 GGCCCAGGACATCCTTCTGAGGG + Intronic
1166140400 19:40802291-40802313 CATCGAGGACAGTCTCCTGGGGG + Intronic
1166659123 19:44634207-44634229 GGCCCAGGACAGGCCCCTCATGG + Intronic
1167331935 19:48861475-48861497 TGCCTAGGACACTCTCCTCGCGG + Exonic
1168335080 19:55592890-55592912 GGCCCTGGCCAGTCACCTGGAGG - Exonic
1168721509 19:58557279-58557301 AGCCCAGGAGAGGCGCCTGGGGG - Intronic
925271674 2:2614240-2614262 GGCCCAGGTCAGTGACCAGGAGG + Intergenic
925271788 2:2615048-2615070 GGCCCAGGTCAGTGACCAGGAGG - Intergenic
925378796 2:3409006-3409028 GGCCAGGGGCAGTCTCCTGGCGG + Intronic
925400685 2:3570103-3570125 GGCCCAGGACAGAATACTGCTGG - Intergenic
925414739 2:3661482-3661504 GGCCCAGGACCATCTGCTGGAGG + Intronic
929863494 2:45698773-45698795 GGCCAAGGACAGACTTGTGGAGG + Intronic
930798729 2:55420168-55420190 CGCCCAGGACGGTTGCCTGGTGG + Intergenic
931937305 2:67213716-67213738 GCCCCAGGACAGCCTGCTGAGGG - Intergenic
932732658 2:74232054-74232076 ATCCCAGGACAGCCTTCTGGAGG + Intronic
934646636 2:96062890-96062912 GGCCCAGGGCTGTGACCTGGAGG + Intergenic
934840037 2:97618972-97618994 GGCCCAGGGCTGTGACCTGGAGG + Intergenic
935794892 2:106631537-106631559 GGTCCAGGTTAGTCTCTTGGAGG - Intergenic
935831792 2:107008094-107008116 GGCCCAGGGCATTCTCTTAGAGG + Intergenic
936799728 2:116252624-116252646 GGCCCAGGACGGGCCCCTCGTGG - Intergenic
937053291 2:118909543-118909565 GGTCCAGGAGAGTCTATTGGAGG - Intergenic
937549568 2:123070284-123070306 GACTCAGGAAGGTCTCCTGGTGG + Intergenic
937928688 2:127188094-127188116 GTCCACGGACAGGCTCCTGGGGG + Intronic
937969236 2:127536614-127536636 GGCCCAGGTCAGACAGCTGGTGG + Intronic
940797133 2:158091763-158091785 TGCCCAGGGTAGTCTGCTGGAGG - Intronic
941562033 2:167058622-167058644 GGCCCAGGCTATTCTGCTGGAGG - Intronic
941843133 2:170108982-170109004 GGCCCATGACAGTGTCCTGGAGG + Intergenic
942897955 2:181080781-181080803 GGGACAGGACAGGCCCCTGGGGG + Intergenic
943526467 2:189022530-189022552 TGCTGAGGACAGTCTCCAGGTGG - Intergenic
946307744 2:218865745-218865767 GGCCCAGGACAGTCTCCTGGGGG + Intronic
947623709 2:231606235-231606257 GGCCCAGGACTGTTTTCTGAGGG - Intergenic
948124752 2:235556394-235556416 GGCCCAGGCCAGTCTCGTCCAGG + Intronic
948223820 2:236293468-236293490 GCCCCAGGAGAGACACCTGGGGG - Intergenic
948257641 2:236579399-236579421 GACCCAGGACTGTGGCCTGGAGG + Intronic
948982465 2:241501338-241501360 TGCCCAGGGCAGTTTCCCGGAGG + Intronic
948988179 2:241538813-241538835 GGCCCAGGTGAGCCTCCTGGAGG + Intergenic
949013420 2:241695337-241695359 TGGACAGGACAGTCACCTGGTGG + Intergenic
1169957355 20:11119374-11119396 GGTCCAGGACAAACTCCTGATGG - Intergenic
1170243333 20:14194050-14194072 GCTCCAGGTCAGTCTACTGGAGG + Intronic
1171388178 20:24784270-24784292 GGCTCAGGACCTCCTCCTGGTGG - Intergenic
1171521196 20:25775054-25775076 TGCCCAGGGCAATCTTCTGGGGG - Exonic
1172434178 20:34916866-34916888 GGACCAGGATAGTCTCAAGGAGG - Intronic
1173067035 20:39723014-39723036 GGCCCGGGACAGGCCCCTCGTGG - Intergenic
1174421052 20:50399414-50399436 CTCCCAGCACAGTCTCCTGGGGG + Intergenic
1174485000 20:50855537-50855559 GTCCCAGGAAGGTCTCTTGGAGG - Intronic
1175326555 20:58133144-58133166 GGCCCAGGAGAGTCCCCAGTGGG + Intergenic
1176249286 20:64112591-64112613 GGCCCAGGCCTGTCTCCTCTTGG + Intergenic
1176263270 20:64194494-64194516 GGGCCAGGACACCCTCCTGCTGG + Intronic
1177205854 21:18010355-18010377 AACTCAGGAAAGTCTCCTGGTGG + Intronic
1178273623 21:31216598-31216620 CGCCAAGGCCAGTCTCCTGCTGG - Intronic
1178595220 21:33947393-33947415 GGCCCAGCACAGTTTCCCTGTGG + Intergenic
1178942816 21:36921556-36921578 GGCTCAGGAAAGCCTCATGGTGG + Intronic
1179607249 21:42524875-42524897 GCCCCAGGACAACCTCCTGGGGG + Intronic
1179726994 21:43346373-43346395 GGGCCAGGACAGGCTCGGGGTGG - Intergenic
1179818011 21:43920500-43920522 GCTCCAGGACAGCCTCCTGGGGG + Intronic
1179966638 21:44810614-44810636 GGCTCCGGCCAGCCTCCTGGAGG - Intronic
1180922128 22:19526301-19526323 GGCCCAGGAGAGGGGCCTGGTGG - Intronic
1181103173 22:20555010-20555032 GGCCCGGGACAGTCTCTGGGCGG + Exonic
1181280161 22:21714072-21714094 GGCACAGGACAGGCTGCTGCCGG - Intronic
1181559603 22:23692467-23692489 GGCCTAGGACAATTTCCTGATGG - Exonic
1183253610 22:36746714-36746736 GGCCCTGGAGAGGCTGCTGGGGG + Intergenic
1183492129 22:38122327-38122349 GTCCCAGGACAATGTCCAGGGGG + Intronic
1183771019 22:39925921-39925943 GGCCATGGAGAGTCTCCTGGAGG - Intronic
1184616163 22:45640047-45640069 AACCCAGGACAGCTTCCTGGAGG + Intergenic
1184650375 22:45916856-45916878 GACACAGGACAGTGGCCTGGAGG + Intergenic
1184718776 22:46297024-46297046 AGCCCAGGCCCGGCTCCTGGCGG - Intronic
1184840827 22:47051556-47051578 GGCCCTGGTGATTCTCCTGGAGG + Intronic
1185060902 22:48606210-48606232 GCCCCAGGACAAATTCCTGGAGG - Intronic
1185210547 22:49568452-49568474 GGCCCAGGGCAGACTCCCAGTGG + Intronic
1185320666 22:50198917-50198939 GGCCCAGGGGCGGCTCCTGGGGG + Exonic
949568197 3:5265024-5265046 TGCCCAGGATAGTCAGCTGGAGG + Intergenic
950032045 3:9859877-9859899 GGCTCAGGGGAGTGTCCTGGTGG + Intergenic
950579677 3:13854038-13854060 GCCCCAGGATGGTGTCCTGGGGG - Intronic
952496662 3:33921840-33921862 GGCCCAGGCTAGGCTTCTGGAGG + Intergenic
953692934 3:45134822-45134844 GGCCCAGGGCAGCTTCCAGGAGG + Intronic
954126830 3:48536263-48536285 GACCCAGGACTGTCCCCTCGGGG - Exonic
954318344 3:49813463-49813485 TGCCCAGGTAAGTGTCCTGGGGG - Exonic
954745438 3:52785097-52785119 GGGCCAAGACAGCATCCTGGGGG - Exonic
955202248 3:56861694-56861716 GGCCCTGAACAGCCTCCTGAGGG - Intronic
955230352 3:57093661-57093683 GGCCCAAGACAGCCCTCTGGAGG + Exonic
956798783 3:72738831-72738853 GGCCCAGGGCAGGTGCCTGGAGG - Intergenic
957770427 3:84684752-84684774 AGCCCAGGATAGCCTGCTGGAGG - Intergenic
958266721 3:91446473-91446495 GGCACAGACCAATCTCCTGGTGG - Intergenic
960161118 3:114351252-114351274 GGCCGAGCGCAGTCTCGTGGTGG + Exonic
961104596 3:124230350-124230372 GATCCAGGAAGGTCTCCTGGAGG - Intronic
961323288 3:126093367-126093389 GGCCCAGGACAGGCCCCTCATGG - Intronic
961365659 3:126397884-126397906 GGCCCAGGGCAGGGGCCTGGAGG + Intronic
963065998 3:141265122-141265144 GGCCCAGGTGAGTCACCTGTAGG + Intronic
963259188 3:143176405-143176427 GGCCCTGGCGAGCCTCCTGGTGG + Intergenic
968451644 4:678798-678820 TTCCCAGCACAGGCTCCTGGGGG - Intronic
968548990 4:1212875-1212897 GGCCCAGAACAGCCTCCAGGAGG - Intronic
968601331 4:1511396-1511418 GGCCCAGTGCAGACTCCTGGTGG - Intergenic
968886965 4:3340294-3340316 GTCCCATGGCAGTCCCCTGGGGG + Intronic
968908652 4:3465859-3465881 GGCCCAGGACTCACTGCTGGTGG + Intronic
969461814 4:7333013-7333035 GGCACGGAACAGGCTCCTGGGGG + Intronic
969476585 4:7425678-7425700 GGCCCAGCTCAGTCTTCAGGTGG + Intronic
969573935 4:8025563-8025585 GGCCCAGGACAGGCCCCCTGGGG - Intronic
969611160 4:8228457-8228479 GGCCCAGCACTACCTCCTGGAGG + Exonic
969639511 4:8388604-8388626 GGCCACGGACAGCCTCCTGCAGG - Intronic
973957435 4:56076696-56076718 GGGCCAGAAAAGCCTCCTGGAGG - Intergenic
976977799 4:91185606-91185628 GGCCCAGGACAGGCCCCTCATGG + Intronic
977536101 4:98258926-98258948 GGCCCAGGCTGGTCTTCTGGAGG + Intergenic
978054934 4:104252250-104252272 TGCCCAGAACAATGTCCTGGAGG - Intergenic
984176410 4:176423796-176423818 AGCCCAGGACAGTTTTCTTGAGG + Intergenic
985538469 5:477054-477076 GGACCAGGACAGGCTGCTGCGGG + Intronic
986646651 5:9922893-9922915 GGCCCACTACTGCCTCCTGGTGG + Intergenic
989453960 5:41620610-41620632 GGCACAGGACAGGTACCTGGGGG - Intergenic
990232028 5:53723424-53723446 GGCCAAGTACAGTCTCTTGAGGG + Intergenic
992233123 5:74683128-74683150 GGCCCTGCACCGTATCCTGGAGG - Intronic
992774239 5:80075974-80075996 GGCCCAGGACAGGCCGCAGGTGG + Intronic
996696770 5:126405660-126405682 GGCAAAAGACAGTCTCCTTGAGG + Intronic
998107720 5:139478845-139478867 GCCCCAGATCAGTCTCCTAGCGG + Intronic
998186305 5:139982383-139982405 GGGCCAGGACACAGTCCTGGCGG - Intronic
998332932 5:141345506-141345528 GACCGAGGACACTCTCCAGGGGG + Exonic
1001525157 5:172423624-172423646 GTCCCAGGACAGACTCCTACTGG - Intronic
1002196447 5:177504123-177504145 GGCCAACGACAGTACCCTGGAGG - Exonic
1002742461 5:181443605-181443627 GGCCCAGGACTGACCCCTGGAGG + Intergenic
1003393455 6:5732941-5732963 GGGCCAGGACTGTCTCCTGGTGG - Intronic
1006381517 6:33700673-33700695 GAACCAGTACAGTCTCCAGGAGG + Intronic
1006439378 6:34043644-34043666 GGCTGAGGCCAGCCTCCTGGGGG - Intronic
1006837707 6:37008956-37008978 AGCCCAGGACAGTCAGCAGGAGG + Exonic
1007078434 6:39082558-39082580 GGACCAGGACTGCCTCCTGTGGG - Intronic
1007905867 6:45460172-45460194 GGCCAAGGACAGATCCCTGGGGG + Intronic
1008988490 6:57575121-57575143 GGCCCAGACCAATCTCCTGGTGG + Intronic
1009177098 6:60473711-60473733 GGCCCAGATCAATCTCCTGGTGG + Intergenic
1011184112 6:84655247-84655269 AGCCCAGGCCAGCCTCCTGGAGG - Intergenic
1011344456 6:86353637-86353659 AGGCCAGGCCAGGCTCCTGGAGG + Intergenic
1013481346 6:110555439-110555461 GGCCCAGGAAAGTCCACTTGGGG + Intergenic
1013519307 6:110917958-110917980 GGCCCAGGACAGGCCCCTCATGG - Intergenic
1016290344 6:142522158-142522180 GGCACAGGACAGTCTCCCTCGGG + Intergenic
1017365854 6:153636739-153636761 TGCCCAGACCAGTGTCCTGGAGG + Intergenic
1017812430 6:157993605-157993627 TGCCCAGGTCAATGTCCTGGAGG + Intronic
1017825167 6:158076337-158076359 GACCCTGCACTGTCTCCTGGGGG + Intronic
1018904989 6:168070815-168070837 GGCACATGACTGTCTGCTGGAGG + Intronic
1019247597 6:170719344-170719366 GGCCCAGGACTGACCCCTGGAGG + Intergenic
1019261262 7:83379-83401 GGACCAGGGCCGTCTCCTGGAGG + Intergenic
1019338660 7:497043-497065 GGCCGAGGACATCCTCCTGCAGG - Intergenic
1019603307 7:1895998-1896020 GGCCCAGGCCAGACCCCTGCAGG + Intronic
1021273128 7:18616760-18616782 GGGAGAGGACAGTCTCCTGTTGG + Intronic
1022106503 7:27200761-27200783 GTCCCAGGACATTCCACTGGAGG + Intergenic
1023024019 7:36035163-36035185 GGCCCAGCACACTGTCCGGGTGG - Intergenic
1024992892 7:55250394-55250416 GACTCAGGACAGCCCCCTGGAGG - Intronic
1025249775 7:57344053-57344075 CTTCCAGCACAGTCTCCTGGGGG - Intergenic
1026680906 7:72465937-72465959 AGCCCAGGATTGTCTCGTGGTGG - Intergenic
1027791175 7:82640077-82640099 GGAGCAGGCCAGTCACCTGGTGG + Intergenic
1029525206 7:101089657-101089679 GGCCGAGGACATTTTCCTGAAGG + Exonic
1030236976 7:107274523-107274545 GGCCCAGGATAGGCTGCTGCAGG + Intronic
1030598835 7:111570414-111570436 GGCCCAGGACAGTGGACTGGTGG + Intergenic
1032078606 7:128847836-128847858 GGCCCAGCACAGCCACCTGCAGG - Exonic
1032094747 7:128932430-128932452 GGAACAGGACAGACTCCTGGAGG + Intergenic
1032391663 7:131558842-131558864 GGCACAGGCCAGTTACCTGGGGG - Intergenic
1033598571 7:142873432-142873454 GGCCCAGGTGAGCCCCCTGGTGG - Exonic
1034260142 7:149750150-149750172 GGCCCGGGTCAGCCTCCTGGAGG + Intergenic
1034267848 7:149789816-149789838 AGCCCTGGTGAGTCTCCTGGAGG + Intergenic
1034393253 7:150801619-150801641 TGGCCAGGGCAGACTCCTGGTGG - Exonic
1035500540 8:88592-88614 GGCCCAGGACTGACCCCTGGAGG - Intergenic
1035708822 8:1697100-1697122 GAGCCAGGAGAGTCTCCTGCGGG - Intronic
1037472019 8:19219991-19220013 GGCCAAGTACAGGCACCTGGAGG - Intergenic
1039474036 8:37829977-37829999 GGCCCTGGGCAGCCTCCAGGAGG + Exonic
1040481770 8:47833357-47833379 GGCCCATGACAGAACCCTGGGGG - Intronic
1042217399 8:66439650-66439672 GGTCCAGGAAGTTCTCCTGGAGG + Intronic
1042672637 8:71281659-71281681 GGCTAGGGCCAGTCTCCTGGAGG + Intronic
1049641506 8:143718070-143718092 GGCCCAGGCCACTCACCTGGAGG - Exonic
1049989881 9:980876-980898 GTCCGAGGACACTCCCCTGGAGG - Intronic
1051636177 9:19182861-19182883 GCCCCAGGACTCTCTCCTGTGGG + Intergenic
1052956105 9:34254327-34254349 AGCCCAGCACAGACTCCTGCAGG + Exonic
1056887225 9:90455125-90455147 AGCAAAGCACAGTCTCCTGGGGG + Intergenic
1057129280 9:92641981-92642003 GGCCAAGGACTCTCTCCTGGGGG + Intronic
1059123917 9:111665575-111665597 AGCCCAAGATAGCCTCCTGGAGG - Intronic
1059339252 9:113588131-113588153 TGCCCAGGCCAGTCCCCTGCAGG - Intronic
1059460057 9:114423967-114423989 GGCACAGCACAGTCACCTGGAGG + Intronic
1060374886 9:123108857-123108879 AGCCCAGGGAAGTGTCCTGGTGG - Intergenic
1060794296 9:126503966-126503988 GGCCGAGCACAGCGTCCTGGTGG - Exonic
1061398401 9:130355592-130355614 GGCCCTGGAAGGCCTCCTGGAGG + Intronic
1062265175 9:135683622-135683644 GGCCCCGGGCAGTGGCCTGGTGG - Intergenic
1062346662 9:136118292-136118314 GACCCAGGACTGTTTCCTCGGGG + Intronic
1062444196 9:136586876-136586898 GGCCCAGGTGAGCCTCCCGGAGG + Intergenic
1062529551 9:136993895-136993917 GGCCCAGGACAGGCAGGTGGAGG - Exonic
1062530181 9:136996261-136996283 GGCCCAGCCCAGTCTTCTGGAGG - Intronic
1203759520 EBV:4882-4904 GGGCCATGAAAGCCTCCTGGCGG + Intergenic
1203608368 Un_KI270748v1:74824-74846 GGCCCAGGACTGACCCATGGAGG + Intergenic
1186216935 X:7310707-7310729 GGCCCAGGACAGAGCCCTGGAGG - Intronic
1187506701 X:19884116-19884138 TGCCCAGGACAGTGTCTTAGAGG - Intronic
1188440354 X:30209938-30209960 GGCCTAGGACAGTCATCAGGAGG - Intergenic
1190277203 X:48906496-48906518 GCACCAGGACAGCCTCATGGAGG + Exonic
1192158060 X:68761378-68761400 GACCAAGGAAAGTTTCCTGGAGG - Intergenic
1192181302 X:68917392-68917414 GACCAAGGTCAGTCTCCAGGAGG + Intergenic
1193921833 X:87437581-87437603 GGGCCAGAACAATGTCCTGGAGG + Intergenic
1194536111 X:95107302-95107324 GGCCCAGGACAGGCCCCTCATGG + Intergenic
1195239538 X:102937438-102937460 GTCCCCGTACAGTCACCTGGGGG + Exonic
1195259996 X:103122529-103122551 GCCCCAGTGCAGGCTCCTGGGGG - Intergenic
1195368863 X:104153036-104153058 GGCCCTAAACAGACTCCTGGAGG - Intronic
1195469977 X:105219983-105220005 GGCCCAGACCAGCCTCGTGGAGG - Exonic
1197262716 X:124334426-124334448 GCCCCAGGACACTCCCCTGGGGG + Intronic
1197262765 X:124334612-124334634 GCCCCAGGACACTCCCCTGGGGG + Intronic
1197262813 X:124334798-124334820 GCCCCAGGGCACTCCCCTGGGGG + Intronic
1198084308 X:133268134-133268156 CCCCCAGGACAGTGTGCTGGCGG - Intergenic
1198835870 X:140804528-140804550 AGCCCAGCCCAGTCTGCTGGTGG + Intergenic
1200184183 X:154170900-154170922 AGCACAAGCCAGTCTCCTGGGGG - Intergenic
1200189836 X:154208028-154208050 AGCACAAGCCAGTCTCCTGGGGG - Intergenic
1200195589 X:154245837-154245859 AGCACAAGCCAGTCTCCTGGGGG - Intergenic
1200201242 X:154282958-154282980 AGCACAAGCCAGTCTCCTGGGGG - Intronic
1200212823 X:154354462-154354484 GGCCCCGGAGAGGCCCCTGGTGG - Exonic
1200256223 X:154584730-154584752 CGCCCAGGACAGACCCCGGGGGG - Intergenic
1200261546 X:154619673-154619695 CGCCCAGGACAGACCCCGGGGGG + Intergenic
1200267528 X:154653970-154653992 CGCCCAGGACAGACCCCGGGGGG + Intergenic