ID: 946308596

View in Genome Browser
Species Human (GRCh38)
Location 2:218870556-218870578
Sequence GGTCCTAGTGGACCACAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 82}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946308596_946308600 11 Left 946308596 2:218870556-218870578 CCAGCTTGTGGTCCACTAGGACC 0: 1
1: 0
2: 0
3: 11
4: 82
Right 946308600 2:218870590-218870612 TGATACTGCTTACTTTTCTTTGG 0: 1
1: 0
2: 0
3: 21
4: 263

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946308596 Original CRISPR GGTCCTAGTGGACCACAAGC TGG (reversed) Intronic
900191897 1:1355597-1355619 GGTCCCAGTGGAGCACGCGCTGG + Exonic
900966058 1:5959411-5959433 GGGCCAAGGGGACCACAAGATGG - Intronic
902511202 1:16967879-16967901 GGTCCCAGGGTACCACAACCTGG - Intronic
904289142 1:29472370-29472392 AGTCCCAGTGGACCACAAGTCGG + Intergenic
904594584 1:31635368-31635390 GGGCCTTATGGACCACCAGCTGG - Exonic
912167757 1:107060373-107060395 GGTGCCATTGGACCACAGGCAGG + Intergenic
917114569 1:171589531-171589553 GGTCCTTGTGGATCACTATCTGG + Intronic
920238934 1:204529515-204529537 GGGCCTTATGGACCACCAGCTGG - Intronic
921196195 1:212760183-212760205 GGTACCAGTGGCCCACAGGCTGG - Intronic
1067962888 10:50876336-50876358 TGTCCAAGTGGAGCACAGGCTGG - Intronic
1075314162 10:121438748-121438770 GGCCTTAGGGGACCAAAAGCTGG - Intergenic
1075918190 10:126187815-126187837 GGACCTAGTGGAACATAAGGAGG - Intronic
1075977912 10:126712814-126712836 GTTCCTAATGGGCCACAAACTGG - Intergenic
1083938624 11:65883262-65883284 GGACAGAGTGGTCCACAAGCTGG - Exonic
1084181828 11:67450776-67450798 GGCCCTGGTGAACCACAAGCTGG - Intergenic
1089611223 11:119670512-119670534 GGTCCCAGTGGGCCCCATGCAGG - Intronic
1089707151 11:120286937-120286959 AGCCACAGTGGACCACAAGCAGG + Intronic
1092956321 12:13553585-13553607 GGTCCTGTTGGACCACCACCTGG + Exonic
1093411608 12:18875162-18875184 CGTTCTAGGGCACCACAAGCTGG + Intergenic
1095486472 12:42689839-42689861 GTTCCTGGAGGACCACACGCTGG + Intergenic
1096615040 12:52827465-52827487 GAACCTAATGGACCACAAGGAGG + Intronic
1105762330 13:23526254-23526276 TGTCCTCCTGGACCACAAGGGGG - Intergenic
1109814962 13:67569414-67569436 GGACCATGTGGACCACAAGGAGG + Intergenic
1119187850 14:72656366-72656388 AGTCGTAGTGGATCACAAGCTGG - Intronic
1119557722 14:75566440-75566462 AGTCCTGGTGGCACACAAGCTGG - Intergenic
1131512123 15:93055275-93055297 GGTCCCACTGCAACACAAGCAGG + Intronic
1132692460 16:1187687-1187709 GGTCAGAGTGGCCCCCAAGCAGG - Intronic
1140126121 16:72120281-72120303 GGTCTGAGTGGACCAGGAGCTGG + Intronic
1140661518 16:77194327-77194349 TTCCCTAGAGGACCACAAGCTGG + Exonic
1146184749 17:30717499-30717521 GGGCCTTGTGGACCTCAAGGAGG - Intergenic
1146905955 17:36618042-36618064 GGTCCCAGTGGAGCAGCAGCTGG + Intergenic
1150069616 17:62139909-62139931 GGCCGTGGTGGACCACCAGCAGG + Intergenic
1156502491 18:37568299-37568321 TGTCCTAGGGGACCAGAAGGAGG - Intergenic
1159849837 18:73514724-73514746 GGACCAGGTGTACCACAAGCAGG + Intergenic
1160183421 18:76655671-76655693 GGTCCTGGAGGACCAGGAGCAGG - Intergenic
1161245554 19:3249720-3249742 GGTCTGAGAGGACCACAAGTTGG - Intronic
1161589529 19:5123023-5123045 AGTCCTAGTGCCCCACCAGCAGG - Intronic
1162835996 19:13318413-13318435 TGGCCTGGTGGACCACAAGGAGG + Intronic
1166324013 19:42038134-42038156 GGTTCTATTGGAGGACAAGCTGG + Intronic
925559114 2:5168827-5168849 GGTCCCAGTGTAGCAGAAGCAGG + Intergenic
926356474 2:12045273-12045295 GCTCCTAGTGGCCCATAATCTGG + Intergenic
930024041 2:47019548-47019570 GGTCAGAGTGGATCACAAGTTGG + Intronic
932478572 2:72024437-72024459 CCTCCTAGTGGAGCACAAACCGG - Intergenic
935901756 2:107800160-107800182 GGTGCCAGTGGTCCTCAAGCTGG - Intergenic
939028917 2:137047058-137047080 GGTCCTATAGGACCACAATAGGG + Intronic
946308596 2:218870556-218870578 GGTCCTAGTGGACCACAAGCTGG - Intronic
1171354685 20:24534696-24534718 GGACCTAGGTGACCACCAGCAGG - Intronic
1175957381 20:62618328-62618350 GGTCCTAGTGGGGCACAAACAGG - Intergenic
1181085317 22:20437018-20437040 GCTCGAAGTGGACCAGAAGCGGG - Intronic
1183784374 22:40021155-40021177 GCTCCTTGTGGGCCACACGCTGG - Intronic
1184477305 22:44728710-44728732 GCTCCCAGTGGAACCCAAGCAGG - Intronic
1185095643 22:48804627-48804649 TGTCCTGGAGGACCACAGGCTGG + Intronic
950536582 3:13582416-13582438 GGTCCTAGAGGCCCACAGCCTGG - Intronic
952452862 3:33448044-33448066 TGTCCTCCTGGACCACAAGGAGG - Intergenic
953403895 3:42650870-42650892 GGTCCTAGGTGACCAGAGGCTGG - Intergenic
954001188 3:47558410-47558432 GGTCCAAGTGGCCCAAACGCTGG - Intergenic
955508794 3:59658712-59658734 GGTACCAGTAGACCACCAGCTGG - Intergenic
959374267 3:105568689-105568711 GGTCTAAGTAGACCAAAAGCTGG - Intronic
961008583 3:123421511-123421533 GGTCATAGTGGACCACACCCAGG - Intronic
961372743 3:126441319-126441341 GCTGCTAGTGCGCCACAAGCAGG + Intronic
962685104 3:137840065-137840087 GTTCCTAGTGGACCACGGACTGG + Intergenic
962927090 3:140004933-140004955 GGTCCCAGTGGACCAATAGAAGG - Intronic
968450954 4:675698-675720 GTTCCTAACGGGCCACAAGCTGG - Intronic
969220186 4:5754102-5754124 GGTCCTAGTGGACTGTAAGCTGG + Intronic
973686095 4:53371321-53371343 GGTTCTTGTGGACCACTACCAGG - Intergenic
977755982 4:100672746-100672768 GGTCCGTGTGATCCACAAGCAGG + Intronic
994082144 5:95718867-95718889 GGTCCCAGGAGAGCACAAGCAGG + Intronic
1003413315 6:5885447-5885469 GGGCCTAGTGGACCACACTGAGG - Intergenic
1007398983 6:41593072-41593094 GGTCAAAGTGGACCTCAAGCTGG - Intronic
1017123085 6:151042135-151042157 GGTCTTAGATGACCACGAGCTGG - Intronic
1017826682 6:158086862-158086884 GGACCTGGTGGAGCTCAAGCGGG + Exonic
1018014517 6:159699888-159699910 GTTCTCAGTGGACCACAATCTGG - Intronic
1018459480 6:163984397-163984419 GCACCCAGTGGACTACAAGCTGG + Intergenic
1019440493 7:1043815-1043837 GGGCCGAGTGGAACACCAGCAGG - Intronic
1021894759 7:25223362-25223384 GGTCTTAGCAAACCACAAGCAGG - Intergenic
1023880814 7:44320316-44320338 GGTCAGAGTAGACCACAAGCTGG + Intronic
1035044619 7:155955465-155955487 TTTCCTTGTGGACCACTAGCTGG + Intergenic
1042377554 8:68071808-68071830 TGCCCTAGTGGAAAACAAGCAGG - Intronic
1042614939 8:70638372-70638394 AGGGCCAGTGGACCACAAGCTGG - Intronic
1044848119 8:96401557-96401579 GGTCCTAGTGAACCGAAAACTGG + Intergenic
1048558361 8:135505370-135505392 GGTCCCAAGGGACCACAAGCAGG - Intronic
1053196666 9:36125160-36125182 AGACATAGAGGACCACAAGCTGG + Intergenic
1053203817 9:36170267-36170289 TGTCCTGATGGACCGCAAGCAGG + Exonic
1058152773 9:101480421-101480443 GGGAATAGTGCACCACAAGCTGG + Intronic
1061446363 9:130640432-130640454 GGCCCTAGTGGACCAGAAGTGGG - Intergenic
1061950910 9:133935390-133935412 GCTCCTTGTGGTCAACAAGCTGG + Intronic
1062217466 9:135397040-135397062 GGTCCCTGTGGACCCCAGGCTGG - Intergenic
1062536779 9:137024513-137024535 GGTCAGAGTAGACCACAAGCTGG - Intronic
1062693211 9:137856442-137856464 GGCCCTAGAGGAGCACATGCAGG + Intronic
1062703262 9:137919202-137919224 GGTCCTACTGAAACACATGCTGG - Intronic
1191160877 X:57328938-57328960 GGTCCTCCTGGACCACTAGAAGG + Intronic
1193468636 X:81874671-81874693 GGACCAGGTGCACCACAAGCAGG + Intergenic
1196900103 X:120374318-120374340 GGTGCTACTGAACCACGAGCAGG + Intronic
1197647708 X:129036042-129036064 TGTCTCAGTGGACCACATGCTGG + Intergenic