ID: 946308600

View in Genome Browser
Species Human (GRCh38)
Location 2:218870590-218870612
Sequence TGATACTGCTTACTTTTCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 263}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946308598_946308600 -10 Left 946308598 2:218870577-218870599 CCATATCATTCCTTGATACTGCT 0: 1
1: 0
2: 2
3: 15
4: 147
Right 946308600 2:218870590-218870612 TGATACTGCTTACTTTTCTTTGG 0: 1
1: 0
2: 0
3: 21
4: 263
946308597_946308600 -1 Left 946308597 2:218870568-218870590 CCACTAGGACCATATCATTCCTT 0: 1
1: 0
2: 0
3: 14
4: 108
Right 946308600 2:218870590-218870612 TGATACTGCTTACTTTTCTTTGG 0: 1
1: 0
2: 0
3: 21
4: 263
946308596_946308600 11 Left 946308596 2:218870556-218870578 CCAGCTTGTGGTCCACTAGGACC 0: 1
1: 0
2: 0
3: 11
4: 82
Right 946308600 2:218870590-218870612 TGATACTGCTTACTTTTCTTTGG 0: 1
1: 0
2: 0
3: 21
4: 263

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946308600 Original CRISPR TGATACTGCTTACTTTTCTT TGG Intronic
901546491 1:9961708-9961730 GGACACTGCTAACTGTTCTTAGG - Intronic
905832017 1:41077219-41077241 TGATACTGTTTTCTTTCCTGAGG + Intronic
907976241 1:59434151-59434173 TGATACTGTAGAGTTTTCTTGGG - Intronic
908308865 1:62855218-62855240 TGAATTTGCTTACTTTTCATGGG + Intronic
910028899 1:82691720-82691742 TTATGCTGCTTTCTTGTCTTGGG + Intergenic
910940583 1:92529265-92529287 TTATGCTCCTTACTTTGCTTTGG + Intronic
911450079 1:98050938-98050960 TGATTCTGCTGTCTTTTCTTTGG + Intergenic
911564748 1:99450614-99450636 TTATACTGATTTCTTTTCTTTGG - Intergenic
916583848 1:166132431-166132453 TATTACTGCTTACCTTTATTGGG + Intronic
917320489 1:173775929-173775951 TTATACTGGTTTCCTTTCTTTGG + Intronic
917339752 1:173963935-173963957 TTATATTGCTAACTTTTCTTAGG - Intronic
917995130 1:180429891-180429913 TGATAATAATTACTTTTCATTGG - Intronic
918265015 1:182833762-182833784 TGAAATTGTTTAGTTTTCTTGGG + Intergenic
918579870 1:186113654-186113676 TGATATTTCTTATTTCTCTTTGG - Intronic
921460576 1:215421504-215421526 TGATCCTCTTTTCTTTTCTTGGG + Intergenic
921674527 1:217963331-217963353 TGATCCTGCATATTTCTCTTTGG - Intergenic
921690854 1:218147995-218148017 TGAGACTGGTTAGTTCTCTTGGG - Intergenic
921977215 1:221216231-221216253 GGATACTTCTTAGGTTTCTTTGG - Intergenic
922065951 1:222143400-222143422 TTATATTGATTACTTTTCTTTGG - Intergenic
923008786 1:230072211-230072233 TGCTACTGCTCATGTTTCTTAGG + Intronic
923373322 1:233334425-233334447 TGATACTGTATTCGTTTCTTGGG + Intronic
923632340 1:235659576-235659598 TGCTACTGCTCAGTTCTCTTTGG + Intergenic
923737117 1:236620696-236620718 TGTTCCTGCTTAGTATTCTTCGG + Intergenic
923928377 1:238662372-238662394 GGATAATGGTTATTTTTCTTTGG + Intergenic
1064566354 10:16642998-16643020 GTTTACTGCTTACTTTACTTAGG + Intronic
1065541376 10:26772165-26772187 TGATACTGCTTACTTCTATCTGG + Intronic
1066005972 10:31146538-31146560 TGATACAGCTGGCTTTTCTGGGG - Intergenic
1068644253 10:59448195-59448217 TGATACTACTTGCATCTCTTAGG + Intergenic
1069995745 10:72341116-72341138 TCATACTGCTTCCTCTTCTCCGG + Exonic
1070078969 10:73167365-73167387 TGATACCTCTTAATTTTCTAAGG + Intronic
1071256034 10:83872566-83872588 TGATAATGCTTACATGTGTTTGG - Intergenic
1071896179 10:90069337-90069359 ATATACTGGTTTCTTTTCTTCGG + Intergenic
1072340497 10:94443678-94443700 TGCTACTACATACTTTTCTGTGG + Intronic
1073087182 10:100900108-100900130 TGAAACTGCTTCCTCTCCTTTGG + Intergenic
1075230320 10:120671152-120671174 TGATTTTCCTTGCTTTTCTTGGG - Intergenic
1076409704 10:130237257-130237279 GGAAACTCCTAACTTTTCTTGGG + Intergenic
1078675999 11:13414897-13414919 TGTTACTGGTTACTTTGGTTCGG - Intronic
1079516215 11:21272488-21272510 GGATTCTGCTGACTTTTCTTTGG - Intronic
1080228292 11:29985910-29985932 TGATGCTGCTTTATTTTCTGGGG - Intergenic
1081457056 11:43233945-43233967 TGATAATGCTTGCTTTCTTTTGG - Intergenic
1084544379 11:69807354-69807376 TGATCCTGCTTTCATTTCTTTGG + Intergenic
1085893979 11:80614778-80614800 TGTTTCTGCTTAATTTGCTTAGG + Intergenic
1086887263 11:92220767-92220789 GGCTACTGCTTTCTTCTCTTTGG - Intergenic
1089930742 11:122308860-122308882 TGCTACTCATTCCTTTTCTTGGG + Intergenic
1090448609 11:126786344-126786366 TGATTCTTTTTTCTTTTCTTTGG + Intronic
1090473487 11:127000259-127000281 TGGTACTGTTTATTTTCCTTTGG - Intronic
1092694813 12:11159428-11159450 TAAAACTGTTTACTATTCTTTGG - Intronic
1093726750 12:22521729-22521751 ACATACTGCTTAATTTTATTTGG - Intronic
1093934988 12:24990833-24990855 TCATACAGCTTACTTTTCACAGG - Intergenic
1094189925 12:27687715-27687737 TTATGCTTCTTCCTTTTCTTGGG + Intronic
1094875682 12:34640106-34640128 GGATTCTGCTTCCTTTTGTTGGG - Intergenic
1095408787 12:41899046-41899068 TGATACAGATTTCCTTTCTTTGG - Intergenic
1098124715 12:67278518-67278540 TGATAGTGCTTTCTTGTTTTGGG + Intronic
1098351276 12:69563671-69563693 TAATCCTGCTCTCTTTTCTTGGG + Intronic
1098649497 12:72946574-72946596 ATATATTGATTACTTTTCTTTGG - Intergenic
1099032143 12:77539802-77539824 TGTTACTGCTTCATTTTTTTGGG - Intergenic
1099357339 12:81654267-81654289 TTATACTGATTTTTTTTCTTAGG + Intronic
1099521075 12:83663465-83663487 GGATATTGCTTCCTTTTATTAGG + Intergenic
1099676447 12:85766934-85766956 AAATTCTGCTTACTTTTGTTGGG - Intergenic
1099874295 12:88385469-88385491 CAAAACTGCTTAATTTTCTTTGG - Intergenic
1102850197 12:116235367-116235389 TGGGAATGATTACTTTTCTTTGG - Intronic
1106068787 13:26386313-26386335 TGATTCTGCTTCATTCTCTTTGG + Intronic
1106209266 13:27625902-27625924 TGGTAATGTTTACTCTTCTTAGG - Intronic
1107313855 13:39109886-39109908 TGTTACAGTTTAGTTTTCTTGGG + Intergenic
1108436740 13:50408245-50408267 TGATATTCCTTGCTTTTCCTTGG - Intronic
1110225705 13:73117413-73117435 TTACAGTGCTTACTGTTCTTGGG + Intergenic
1110522678 13:76499147-76499169 TAATAACTCTTACTTTTCTTAGG - Intergenic
1110965706 13:81693107-81693129 TCATGCTGCTTTCATTTCTTTGG + Intergenic
1111376186 13:87381337-87381359 AGATACTGCTTTATTTTGTTTGG + Intergenic
1111482023 13:88842088-88842110 TGACAATGCTTAGTTTTGTTAGG - Intergenic
1114864929 14:26578718-26578740 TAATATTTTTTACTTTTCTTTGG - Intronic
1115146071 14:30227334-30227356 TCATTTTGCTTAATTTTCTTAGG - Intergenic
1116019983 14:39448569-39448591 TGATCCTGCTTTCTCTTCTTAGG + Intergenic
1116213986 14:41986946-41986968 TGATATTGCCTACTTTGCATTGG + Intergenic
1116548539 14:46203945-46203967 TGATAATATTTAGTTTTCTTTGG - Intergenic
1117751162 14:58924738-58924760 TGAGCCTGCTTACTTTTGTATGG - Intergenic
1118496285 14:66311017-66311039 TCACTCTGCTTACTTTCCTTGGG - Intergenic
1118888239 14:69884884-69884906 TGTTACTTTTTACTTTGCTTTGG + Intronic
1119871419 14:78021223-78021245 AGATACTGCTACCTTTGCTTTGG + Intergenic
1120379010 14:83749141-83749163 TGATACTGCCTTATTTTCCTTGG - Intergenic
1126937079 15:53722615-53722637 TAATACTGATTACATTCCTTGGG + Intronic
1127039520 15:54958918-54958940 TGATAATTCTTCCTTTTCTTTGG - Intergenic
1130395917 15:83501430-83501452 TGATCCTGTTTAATATTCTTGGG + Intronic
1130793155 15:87178265-87178287 TGTTGCTTCTGACTTTTCTTCGG - Intergenic
1132134625 15:99322954-99322976 TGATGCTGCTGATTTTTCTGTGG + Intronic
1133548429 16:6830453-6830475 TTATCCTGCTTATTTTTCTAAGG - Intronic
1134323637 16:13187055-13187077 AGATACTGCTTTCAGTTCTTTGG + Intronic
1135428350 16:22359596-22359618 TGATAATGCTTACACTGCTTTGG - Intronic
1136919561 16:34252954-34252976 TGTTTCTGTCTACTTTTCTTGGG - Intergenic
1137841195 16:51642413-51642435 TGAAAATGCAGACTTTTCTTTGG + Intergenic
1140537093 16:75719688-75719710 TGATTCTGCTGCCTTTTATTTGG - Intronic
1141290252 16:82712037-82712059 TTATACTCCATACTTCTCTTGGG + Intronic
1141848415 16:86627028-86627050 AGATGCTGCATATTTTTCTTGGG - Intergenic
1146075975 17:29729545-29729567 TTATACTGATTTCCTTTCTTTGG - Intronic
1146090961 17:29877381-29877403 ATATACTGATTTCTTTTCTTTGG - Intronic
1147815895 17:43210386-43210408 TGAAACTGAGTATTTTTCTTTGG + Exonic
1149635331 17:58163033-58163055 TAATACTTTTTATTTTTCTTAGG + Intergenic
1150271862 17:63872017-63872039 TGATACAACTTAATTTTATTAGG + Exonic
1150275411 17:63894918-63894940 TGATACAACTTAATTTTATTAGG + Exonic
1154263913 18:12862744-12862766 TATTTCTGCTTACCTTTCTTAGG - Intronic
1155485333 18:26335592-26335614 TGATACTGCTTATAATTCTTTGG + Intronic
1156151251 18:34246174-34246196 TTATAATTCTTACCTTTCTTAGG + Intergenic
1156476213 18:37407075-37407097 ACCTACTGCTTACTCTTCTTTGG + Intronic
1156703780 18:39855762-39855784 TGATACTTTTTACATTACTTGGG - Intergenic
1157248842 18:46076225-46076247 TGATATTGATGAGTTTTCTTTGG - Intergenic
1157379552 18:47200395-47200417 TAATTCTGTTTACTTTTCTGAGG + Intergenic
1158101374 18:53833921-53833943 TGTTTCTGCTTCCTTTTGTTTGG + Intergenic
1158827646 18:61241733-61241755 TGATATTGCTTGCTTTCCATGGG + Intergenic
1159713607 18:71794075-71794097 TGTTTCTGCTTTGTTTTCTTTGG + Intergenic
1159861165 18:73651336-73651358 TGAAACTACCTCCTTTTCTTGGG - Intergenic
1165608983 19:37134046-37134068 TGGTACTCCTTACTCCTCTTTGG + Intronic
1165876028 19:39007500-39007522 TGTTTCTTCTTATTTTTCTTTGG + Intronic
1166150466 19:40870359-40870381 ATATACTGATTTCTTTTCTTTGG + Intronic
1167550704 19:50158772-50158794 TGATCCTGCTCACTTTCCATTGG - Intronic
925814848 2:7737468-7737490 TGAAAGTGCTTGCATTTCTTGGG - Intergenic
926221631 2:10939846-10939868 TGGTACTGCTTACCCTTCATTGG + Intergenic
926261752 2:11270351-11270373 TTATTCTGCTTTCTGTTCTTTGG + Intronic
926751304 2:16200772-16200794 TAATACTGCATATTTTTCTCTGG - Intergenic
926935950 2:18086710-18086732 TCATACTGTTAACTTTTCCTTGG + Intronic
927412310 2:22840856-22840878 TGAAAATGATTACATTTCTTGGG + Intergenic
928795390 2:35013017-35013039 GGATTCTGCTGCCTTTTCTTTGG - Intergenic
929188936 2:39122025-39122047 TGATCCTGGTTACTGTTCTCAGG - Intronic
930297361 2:49571579-49571601 ATATACTGATTTCTTTTCTTTGG + Intergenic
930444955 2:51458729-51458751 CAATCCTACTTACTTTTCTTTGG + Intergenic
930668562 2:54123865-54123887 TGATACGGCTTACATTTCATTGG + Intronic
931027000 2:58121818-58121840 TGAAACTGCTTTCTTTTTCTGGG + Intronic
932964143 2:76450863-76450885 TCATACAGCTTCCTTTTTTTTGG - Intergenic
933433605 2:82215679-82215701 TGATACAGCCTATTTTTCCTAGG + Intergenic
933534861 2:83558626-83558648 TCATCCTGCTTAAGTTTCTTCGG - Intergenic
940388162 2:153098407-153098429 TGATAGTGATTAATTTTATTAGG - Intergenic
941229743 2:162896837-162896859 AGATACTGATTTCCTTTCTTTGG + Intergenic
941231194 2:162914221-162914243 AGATTCTGATTACTTATCTTTGG - Intergenic
941810730 2:169753887-169753909 AAATACGGCTTACATTTCTTAGG + Intronic
943902649 2:193460670-193460692 AGATACTGCTTAACTGTCTTAGG + Intergenic
944666938 2:201966744-201966766 TGAAAATCCTTACTTTGCTTTGG + Intergenic
945636548 2:212360305-212360327 TGATGCTGAAAACTTTTCTTTGG - Intronic
946030406 2:216699255-216699277 TGTTCATGATTACTTTTCTTTGG + Intergenic
946308600 2:218870590-218870612 TGATACTGCTTACTTTTCTTTGG + Intronic
946783020 2:223211756-223211778 ATATACTGATTCCTTTTCTTTGG - Intergenic
947185220 2:227449048-227449070 TGTTAATGCTTGCTTATCTTGGG + Intergenic
947365637 2:229391936-229391958 TGATTCTGCTTGCTTTCCTTGGG + Intronic
947516094 2:230806330-230806352 TCATACTGCTTAATTGTATTGGG - Intronic
948004595 2:234596894-234596916 TGAAATTGCTTTCTTTTCTTTGG - Intergenic
1169696363 20:8391679-8391701 TGATACTACTTACTTCCCTATGG + Intronic
1169821052 20:9710558-9710580 AGATACTGCTGACTTGGCTTAGG - Intronic
1169869059 20:10231907-10231929 CTATACTGCTTACATCTCTTTGG + Intronic
1170006603 20:11676549-11676571 TGGTACTACTTACTTTTTATAGG - Intergenic
1173680500 20:44876595-44876617 TTATACTGCTCTCCTTTCTTGGG - Intergenic
1173772369 20:45672572-45672594 TGTTCCTGCTTAATTTGCTTAGG - Intergenic
1174880792 20:54277295-54277317 TTATACTGCTTGCTTTTTTGGGG + Intergenic
1177452136 21:21283575-21283597 TGAAACTACTTATTTCTCTTGGG + Intronic
1177967626 21:27747898-27747920 TGAAACAGCTTAACTTTCTTTGG + Intergenic
1178044438 21:28677482-28677504 GGATACTGCTGCCTTTTGTTTGG - Intergenic
1179114971 21:38482522-38482544 AGATAGTGATTACATTTCTTTGG - Intronic
1179313942 21:40224178-40224200 TTATACTGCTTTGATTTCTTGGG - Intronic
1179521940 21:41951367-41951389 TGGTATTGCTTACTTTCCTGGGG - Intronic
1182665160 22:31952915-31952937 TAATCCTGCTTATTTTACTTTGG + Intronic
949347129 3:3086943-3086965 TGTTCCTGATTACTTTCCTTAGG - Intronic
950694326 3:14686318-14686340 AAATACTGATTTCTTTTCTTTGG + Intronic
951134052 3:19082912-19082934 ATATACTGATTTCTTTTCTTTGG + Intergenic
951312837 3:21150313-21150335 TGATCCTGCTGTCTTTTCATTGG - Intergenic
952914348 3:38221749-38221771 TAATAGTGCTTGCTTTTCTTTGG + Intronic
954936459 3:54331277-54331299 TGATGCTGATTGCTTTTCTATGG - Intronic
955210684 3:56937927-56937949 TGAGACTGATTACTTTTTTATGG - Intronic
956325568 3:68048944-68048966 ATATACTGGTTTCTTTTCTTTGG + Intronic
957334349 3:78807865-78807887 TGCTACTGCTTATTTTTGTTTGG - Intronic
957388382 3:79528738-79528760 TGAAACTGCTTACTTTTAACAGG - Intronic
957960297 3:87240960-87240982 TCATTCTGCTGACTTTTATTGGG + Intronic
958175788 3:89994438-89994460 TAATATTATTTACTTTTCTTGGG - Intergenic
960612709 3:119569642-119569664 TGCTACTGTTTCTTTTTCTTAGG - Intergenic
960735436 3:120774414-120774436 TGATGCTGCTTACTTTGTATAGG - Intronic
961005072 3:123399486-123399508 CCATACTGCTTTGTTTTCTTAGG + Intronic
962363405 3:134760460-134760482 TGATAGTGCTGACTTTTCCCTGG - Intronic
963148758 3:142021915-142021937 TGATACTGCTGGTTTTTCATTGG + Intronic
964059442 3:152504397-152504419 TGATACTAATAACTGTTCTTTGG + Intergenic
964063000 3:152547267-152547289 TGTTACTGCTTAGTTTGCTAAGG + Intergenic
965204288 3:165701209-165701231 TGATCCCTCTTTCTTTTCTTTGG - Intergenic
965348882 3:167588435-167588457 ATATACTGATTTCTTTTCTTTGG + Intronic
965389415 3:168086531-168086553 TGATATTATTTGCTTTTCTTTGG - Intronic
966475722 3:180343493-180343515 ATATACTGATTCCTTTTCTTTGG + Intergenic
968323194 3:197789903-197789925 TGATATAGCTTTCTTTTCTCTGG + Intergenic
969513368 4:7632340-7632362 TTTTACTGCTTACTATTCTGGGG - Intronic
970119335 4:12735185-12735207 AGATACTATTTAATTTTCTTGGG + Intergenic
971280072 4:25235361-25235383 TAACACTGCTTAGTTTTTTTTGG + Intronic
972214022 4:36874311-36874333 TCATACTCCTTGCTCTTCTTTGG + Intergenic
974110647 4:57521459-57521481 GTATACTGATTTCTTTTCTTTGG - Intergenic
974225260 4:59034068-59034090 TGCCACTTTTTACTTTTCTTTGG - Intergenic
975328912 4:73091505-73091527 TGATACTGGATAGTGTTCTTTGG + Exonic
977824515 4:101514913-101514935 TGGTACAGCCTATTTTTCTTTGG + Intronic
979072907 4:116233286-116233308 TGATGTTGCCTACATTTCTTTGG + Intergenic
979243587 4:118472398-118472420 TGATAATTTTTACTTTTATTTGG + Intergenic
979839003 4:125414239-125414261 AGATACTGTTGATTTTTCTTAGG - Intronic
980724830 4:136744564-136744586 TGATAGTGTTTACCTTCCTTTGG - Intergenic
980762066 4:137247644-137247666 TGAAATGGCTTTCTTTTCTTTGG + Intergenic
982326065 4:154129185-154129207 TGATACTGCTTTCTGGTCTGAGG + Intergenic
982916658 4:161219070-161219092 TGATAGTGCATACTTTAATTGGG - Intergenic
983170024 4:164525151-164525173 TGATACTGATTATTTTATTTTGG - Intergenic
983278966 4:165656327-165656349 AGATAATGCTTCCTTTCCTTGGG + Intergenic
984293201 4:177821645-177821667 TGATAGTGCTTACTTTACTGTGG - Intronic
984826141 4:183926546-183926568 TGGATCTGCTAACTTTTCTTAGG + Intronic
985478924 5:95200-95222 TAAAACTGCTTACCTTTCTGAGG + Intergenic
986156762 5:5184093-5184115 TGATTCTGCTCACTTTTCCGGGG - Intronic
986895812 5:12366781-12366803 TTGTTCTGCTTACTTTTGTTTGG + Intergenic
986977863 5:13413413-13413435 TGATACTGCTTTGTTCTCTCTGG - Intergenic
987521958 5:18997689-18997711 TCATACTGGTTAGTTTCCTTAGG + Intergenic
989019131 5:36980129-36980151 TTATACTGCGAACTTTCCTTTGG + Intronic
989975966 5:50587740-50587762 TCATACTGGTTACTATTATTTGG + Intergenic
990014553 5:51043840-51043862 TGATTCTGCTTACTTTACTATGG + Intergenic
990233933 5:53746034-53746056 TGATACCTTTCACTTTTCTTGGG - Intergenic
990253405 5:53940308-53940330 TGATACTGCTTAATTCCCATAGG + Intronic
991257829 5:64634570-64634592 TGATACTGCTTAGATTCCTTAGG + Intergenic
993321579 5:86475289-86475311 TGATACTTTTTAATTTACTTTGG - Intergenic
993852409 5:93026839-93026861 TTATACTGCTTTCCTTTCTTTGG - Intergenic
995203948 5:109457826-109457848 GGATTCTGCTTCCTTTTGTTTGG - Intergenic
995278122 5:110301262-110301284 AAATACTGATTCCTTTTCTTTGG + Intronic
997954412 5:138267512-138267534 TAAGACTTCTTCCTTTTCTTAGG + Intronic
999039816 5:148395782-148395804 TTTTACTGCTTACTATTCTATGG + Intronic
1000772736 5:165377093-165377115 AGATATAGCTTATTTTTCTTAGG + Intergenic
1003693479 6:8377842-8377864 GGGTACTGCTGACTTTTATTAGG + Intergenic
1004640430 6:17509905-17509927 TGATACTTCATTCTTTTATTCGG + Intronic
1004654944 6:17650452-17650474 TGAAACTTTTTAGTTTTCTTTGG - Intronic
1005497510 6:26401054-26401076 TGATAAGGCCTAATTTTCTTAGG - Intergenic
1005502295 6:26439571-26439593 TGATAAAGCCTAATTTTCTTGGG - Intergenic
1006045127 6:31288633-31288655 TGAAACTGCTTGCTGGTCTTGGG + Intronic
1008414578 6:51224913-51224935 TGATTCTGCTGCCTTTTGTTTGG - Intergenic
1008722719 6:54376532-54376554 TGATATTTTTTTCTTTTCTTTGG - Intronic
1009676123 6:66823927-66823949 TGATCCTGCTTTCTTTATTTTGG + Intergenic
1009846599 6:69142886-69142908 TTATACTGCTTTCCTTTCTTAGG + Intronic
1010321897 6:74520931-74520953 ATATACTGATTTCTTTTCTTTGG + Intergenic
1010423444 6:75700323-75700345 TGATTCAGCTTTCTCTTCTTAGG + Intronic
1010724281 6:79314990-79315012 TTATTCTGCTTACTGTTCTGGGG + Intergenic
1011270843 6:85578543-85578565 TGATGCTGTTTGCTTTTTTTAGG - Intronic
1011962837 6:93113008-93113030 TGATACTCCTTGTTTTTCATTGG + Intergenic
1012716693 6:102682562-102682584 ATATACTGATTTCTTTTCTTTGG - Intergenic
1012782894 6:103585566-103585588 ATATACTGATTTCTTTTCTTTGG + Intergenic
1015021126 6:128476501-128476523 TCATACTGCTTACATATTTTTGG - Intronic
1017918517 6:158852107-158852129 TGACACTTCTTCCTGTTCTTGGG - Intergenic
1020503991 7:8960309-8960331 TGATACCGCTCTGTTTTCTTTGG - Intergenic
1024635488 7:51286037-51286059 TGCTACTTCTCATTTTTCTTTGG - Intronic
1024790221 7:52957441-52957463 TAATACTGATTTCCTTTCTTTGG + Intergenic
1025081874 7:55990583-55990605 TGTTAACTCTTACTTTTCTTTGG + Intronic
1026029499 7:66778075-66778097 TCACACTGATTACTTTTGTTTGG + Intronic
1027184301 7:75961224-75961246 TGATACTGCCTTTTTTTTTTTGG - Intronic
1027642917 7:80759235-80759257 TGATACTCCTTACTTTCCAAAGG + Intronic
1027709195 7:81576399-81576421 TGCCACTGCCTACTTTGCTTTGG - Intergenic
1028151479 7:87378526-87378548 TGGTACTGCTTTCTTTTGTTTGG + Intronic
1028969014 7:96836106-96836128 TGATCCTCCTTAAGTTTCTTGGG + Intergenic
1031323765 7:120366091-120366113 AGATAAAGCTTACTTTTCATGGG - Intronic
1035758821 8:2054672-2054694 TGACACCGTTTACTTTTCTATGG - Intronic
1037247441 8:16851688-16851710 TCATGCAGCTTTCTTTTCTTTGG - Intergenic
1037407662 8:18561095-18561117 AGATACTGATTTCATTTCTTTGG - Intronic
1038815277 8:30896680-30896702 TGATACTGCATATCTTTCTGAGG - Intergenic
1039930494 8:41983202-41983224 TGGTCGTGCTTATTTTTCTTTGG + Intronic
1040322383 8:46323297-46323319 TGAAACTGCTTACTGATCTGTGG - Intergenic
1040568728 8:48589762-48589784 TGATGCTGCTTAACTTTCCTTGG + Intergenic
1041859250 8:62493064-62493086 TGTTAATGCTTGCTTTTGTTGGG + Intronic
1044722925 8:95168236-95168258 TGTTTCTACTAACTTTTCTTTGG + Intergenic
1045776993 8:105816309-105816331 ATATACTGATTTCTTTTCTTTGG + Intergenic
1047763912 8:127974377-127974399 TGATGATGCTGACTTTTTTTGGG - Intergenic
1047934568 8:129764341-129764363 TTGTACTGGTTAATTTTCTTAGG + Intronic
1048562963 8:135562373-135562395 TGATACAGCCTACTGTTCCTTGG - Intronic
1051169053 9:14300193-14300215 TGATCATGCTCACTTTTCTGTGG - Intronic
1052656709 9:31372577-31372599 TGATACTGTTTACATTTCCCTGG - Intergenic
1054831169 9:69626735-69626757 TAATAGTTCTTTCTTTTCTTAGG - Intronic
1055006539 9:71513760-71513782 TGAGAGTGCTTACATTTATTGGG + Intergenic
1055736312 9:79334683-79334705 TGGTACTGGTTGCTGTTCTTTGG + Intergenic
1056194790 9:84218860-84218882 TAATATTGCTTAGTTTTCATGGG + Intergenic
1056293462 9:85167586-85167608 TGATACTGCTCACTGTTCAATGG + Intergenic
1058129681 9:101236404-101236426 TGATAGTTATTACTTTTCCTAGG - Intronic
1058922897 9:109634495-109634517 TGTTACTGCTTAATGTTCTCGGG + Intergenic
1061693514 9:132354610-132354632 GGATACTGCGTAGTTTCCTTGGG - Intronic
1188876339 X:35434980-35435002 AGACACTGGTTACTTTTCTAAGG - Intergenic
1189062490 X:37769181-37769203 GGATACTGCTGCCTTTTGTTTGG - Intronic
1190098963 X:47505655-47505677 TGGTACTGATTCCTTTTCATGGG - Intergenic
1190642007 X:52488972-52488994 ATATACTGCTTTCATTTCTTTGG + Intergenic
1190645666 X:52523894-52523916 ATATACTGCTTTCATTTCTTTGG - Intergenic
1194242922 X:91473917-91473939 TGATTCTGCATAGTTCTCTTAGG - Intergenic
1194287713 X:92030968-92030990 TTATACTGGTTTCCTTTCTTTGG + Intronic
1196628885 X:117912155-117912177 AGATAATTCTTACTTGTCTTGGG - Intronic
1197919381 X:131575508-131575530 TGATACTGCCTATTGTTCCTAGG - Intergenic
1198596314 X:138239926-138239948 TGATACATCTTATTTGTCTTTGG - Intergenic
1198639035 X:138735664-138735686 TAAGTCTGCTTACTTTGCTTTGG - Intronic
1200605247 Y:5255528-5255550 TTATACTGGTTTCCTTTCTTTGG + Intronic
1202059122 Y:20867711-20867733 GGATTCTGCTGCCTTTTCTTTGG + Intergenic
1202089034 Y:21169997-21170019 TGCTAGTGCTTCCTTTTCTCAGG - Intergenic