ID: 946308824

View in Genome Browser
Species Human (GRCh38)
Location 2:218871649-218871671
Sequence GGCCCCGCGGGCTCCCCGGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 218}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946308799_946308824 20 Left 946308799 2:218871606-218871628 CCCTCCCCGGCCCTCCGGCCTGC 0: 1
1: 0
2: 5
3: 64
4: 706
Right 946308824 2:218871649-218871671 GGCCCCGCGGGCTCCCCGGAAGG 0: 1
1: 0
2: 0
3: 25
4: 218
946308812_946308824 -3 Left 946308812 2:218871629-218871651 CCGGCACCCCCGGACCCCCTGGC 0: 1
1: 0
2: 9
3: 54
4: 546
Right 946308824 2:218871649-218871671 GGCCCCGCGGGCTCCCCGGAAGG 0: 1
1: 0
2: 0
3: 25
4: 218
946308805_946308824 10 Left 946308805 2:218871616-218871638 CCCTCCGGCCTGCCCGGCACCCC 0: 1
1: 0
2: 1
3: 40
4: 420
Right 946308824 2:218871649-218871671 GGCCCCGCGGGCTCCCCGGAAGG 0: 1
1: 0
2: 0
3: 25
4: 218
946308801_946308824 16 Left 946308801 2:218871610-218871632 CCCCGGCCCTCCGGCCTGCCCGG 0: 1
1: 0
2: 5
3: 41
4: 611
Right 946308824 2:218871649-218871671 GGCCCCGCGGGCTCCCCGGAAGG 0: 1
1: 0
2: 0
3: 25
4: 218
946308803_946308824 15 Left 946308803 2:218871611-218871633 CCCGGCCCTCCGGCCTGCCCGGC 0: 1
1: 0
2: 3
3: 71
4: 582
Right 946308824 2:218871649-218871671 GGCCCCGCGGGCTCCCCGGAAGG 0: 1
1: 0
2: 0
3: 25
4: 218
946308800_946308824 19 Left 946308800 2:218871607-218871629 CCTCCCCGGCCCTCCGGCCTGCC 0: 1
1: 0
2: 5
3: 95
4: 900
Right 946308824 2:218871649-218871671 GGCCCCGCGGGCTCCCCGGAAGG 0: 1
1: 0
2: 0
3: 25
4: 218
946308804_946308824 14 Left 946308804 2:218871612-218871634 CCGGCCCTCCGGCCTGCCCGGCA 0: 1
1: 0
2: 4
3: 55
4: 565
Right 946308824 2:218871649-218871671 GGCCCCGCGGGCTCCCCGGAAGG 0: 1
1: 0
2: 0
3: 25
4: 218
946308808_946308824 6 Left 946308808 2:218871620-218871642 CCGGCCTGCCCGGCACCCCCGGA 0: 1
1: 0
2: 4
3: 41
4: 361
Right 946308824 2:218871649-218871671 GGCCCCGCGGGCTCCCCGGAAGG 0: 1
1: 0
2: 0
3: 25
4: 218
946308798_946308824 21 Left 946308798 2:218871605-218871627 CCCCTCCCCGGCCCTCCGGCCTG 0: 1
1: 0
2: 8
3: 73
4: 1022
Right 946308824 2:218871649-218871671 GGCCCCGCGGGCTCCCCGGAAGG 0: 1
1: 0
2: 0
3: 25
4: 218
946308810_946308824 -2 Left 946308810 2:218871628-218871650 CCCGGCACCCCCGGACCCCCTGG 0: 1
1: 0
2: 13
3: 63
4: 521
Right 946308824 2:218871649-218871671 GGCCCCGCGGGCTCCCCGGAAGG 0: 1
1: 0
2: 0
3: 25
4: 218
946308809_946308824 2 Left 946308809 2:218871624-218871646 CCTGCCCGGCACCCCCGGACCCC 0: 1
1: 0
2: 7
3: 81
4: 688
Right 946308824 2:218871649-218871671 GGCCCCGCGGGCTCCCCGGAAGG 0: 1
1: 0
2: 0
3: 25
4: 218
946308814_946308824 -10 Left 946308814 2:218871636-218871658 CCCCGGACCCCCTGGCCCCGCGG 0: 1
1: 1
2: 1
3: 30
4: 306
Right 946308824 2:218871649-218871671 GGCCCCGCGGGCTCCCCGGAAGG 0: 1
1: 0
2: 0
3: 25
4: 218
946308813_946308824 -9 Left 946308813 2:218871635-218871657 CCCCCGGACCCCCTGGCCCCGCG 0: 1
1: 1
2: 2
3: 24
4: 319
Right 946308824 2:218871649-218871671 GGCCCCGCGGGCTCCCCGGAAGG 0: 1
1: 0
2: 0
3: 25
4: 218
946308806_946308824 9 Left 946308806 2:218871617-218871639 CCTCCGGCCTGCCCGGCACCCCC 0: 1
1: 1
2: 1
3: 72
4: 784
Right 946308824 2:218871649-218871671 GGCCCCGCGGGCTCCCCGGAAGG 0: 1
1: 0
2: 0
3: 25
4: 218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946308824 Original CRISPR GGCCCCGCGGGCTCCCCGGA AGG Exonic