ID: 946309451

View in Genome Browser
Species Human (GRCh38)
Location 2:218874671-218874693
Sequence TATTTGGACTGGAGGAAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 221}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946309451_946309459 12 Left 946309451 2:218874671-218874693 CCAACTTTCCTCCAGTCCAAATA 0: 1
1: 0
2: 3
3: 16
4: 221
Right 946309459 2:218874706-218874728 ATGACTCCCCCATCAAGGTATGG 0: 1
1: 0
2: 0
3: 2
4: 60
946309451_946309458 7 Left 946309451 2:218874671-218874693 CCAACTTTCCTCCAGTCCAAATA 0: 1
1: 0
2: 3
3: 16
4: 221
Right 946309458 2:218874701-218874723 GGGGAATGACTCCCCCATCAAGG 0: 1
1: 0
2: 0
3: 7
4: 83
946309451_946309460 15 Left 946309451 2:218874671-218874693 CCAACTTTCCTCCAGTCCAAATA 0: 1
1: 0
2: 3
3: 16
4: 221
Right 946309460 2:218874709-218874731 ACTCCCCCATCAAGGTATGGAGG 0: 1
1: 0
2: 1
3: 4
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946309451 Original CRISPR TATTTGGACTGGAGGAAAGT TGG (reversed) Intergenic
901321808 1:8344658-8344680 TATTTGGATGGGAGGATATTTGG - Intergenic
902675357 1:18004983-18005005 TATATGGATTGGTGGAAACTTGG + Intergenic
902702939 1:18185031-18185053 TATTTGGTCTTGATGAATGTTGG + Intronic
903032622 1:20474874-20474896 TGTTGGGACTGGGGGAAAGGAGG - Intergenic
903974498 1:27140422-27140444 TATATGGACTGGAGGGCATTGGG - Intronic
904687495 1:32271310-32271332 TATTTGGAGTAGAGCAAAGCTGG - Intronic
906199612 1:43950998-43951020 TTTTGTGAATGGAGGAAAGTAGG + Intronic
908477364 1:64503179-64503201 TAATTGGACTGGCTGATAGTGGG + Intronic
909979304 1:82079515-82079537 TGAGTGGACTGGAGGAAAGTGGG - Intergenic
911799297 1:102113879-102113901 TATTTTGAATGTAGGAGAGTCGG - Intergenic
917673772 1:177300198-177300220 TATTTTGGCTGCAGGAAATTAGG + Intergenic
918909428 1:190546597-190546619 TATTTGGACCAGAGGAATTTTGG + Intergenic
920412309 1:205771833-205771855 GATTTGGACTGGAGCAATCTGGG - Intronic
920839566 1:209542841-209542863 GACTTGGACTTGAGGAAGGTAGG - Intergenic
921634420 1:217476194-217476216 TATTTGGTCTGGAAGAAAAGAGG + Intronic
923236114 1:232034965-232034987 CATTTGAACTTGAGGAAAATGGG - Intronic
923868988 1:237970661-237970683 TATTTTGACTGGTGGCAAGTAGG - Intergenic
923991864 1:239446772-239446794 TATTTGAAGTGGTGGAAAGTTGG + Intronic
1064474639 10:15674243-15674265 TATGTGGGATGGAGGAAAGAGGG - Intronic
1068973819 10:62986724-62986746 TATTAGTACTGGAGTAAAGCTGG + Intergenic
1070793314 10:79202656-79202678 TATTTGGACTGCCGGGAGGTGGG + Intronic
1071169759 10:82850213-82850235 TATTAGCACTGGAAGGAAGTTGG + Intronic
1072052935 10:91724476-91724498 TAGTTTGGCTGGAGGAAAATAGG - Intergenic
1072374911 10:94804361-94804383 CAGTTGGTCTGGAGGAAGGTAGG - Intronic
1073634810 10:105186907-105186929 GATTTAGACAGGAGGAAAGAGGG - Intronic
1074048771 10:109864101-109864123 TAATGGGACAGGAAGAAAGTAGG + Intergenic
1074062164 10:109976632-109976654 AATTTGGAATGTAGGAAACTTGG + Intergenic
1075857859 10:125645712-125645734 TATTAGCATTGGAGAAAAGTGGG + Intronic
1075925755 10:126250738-126250760 TCTTTCCACTGGAGGAAATTGGG - Intronic
1079219839 11:18550546-18550568 GATTTGGACTGGCAGAAAGCTGG - Intronic
1079664377 11:23085068-23085090 TATTGGGAATGGAAGAGAGTTGG + Intergenic
1080114357 11:28605537-28605559 TATTTTAACAGGAGGAAAGTAGG + Intergenic
1080347198 11:31338232-31338254 TATTTGGAAAGGAGGAGAATAGG - Intronic
1081575837 11:44318102-44318124 TCTGGGGACTGGAGGAGAGTAGG - Intergenic
1081676162 11:44970994-44971016 TTCTTGGACTGGAGGGAGGTAGG - Intergenic
1082207618 11:49456884-49456906 TATCTGCCCTGGAGGAAACTAGG + Intergenic
1088790116 11:113217368-113217390 GGAGTGGACTGGAGGAAAGTCGG - Intronic
1092902202 12:13070508-13070530 CACTTGGGCTGGAGGAAATTGGG + Intronic
1092945418 12:13449861-13449883 TATTTGAACTGGGGGAAAGCAGG - Intergenic
1093212862 12:16328302-16328324 TATGTGGAATGGAGGTAATTAGG - Intergenic
1093742704 12:22706497-22706519 TATTTGGAGAGGAGGGAGGTAGG - Intergenic
1094629992 12:32164592-32164614 TATTTGTTATGGAGGCAAGTAGG + Intronic
1095749886 12:45697940-45697962 AGTTTGAAGTGGAGGAAAGTAGG + Intergenic
1097438448 12:59579568-59579590 AGTAGGGACTGGAGGAAAGTAGG + Intergenic
1097727855 12:63095061-63095083 TAGCTTGACTGGAGTAAAGTTGG - Intergenic
1099283440 12:80683687-80683709 TATGTGGACTGTAGGGAATTTGG + Intergenic
1100412014 12:94328756-94328778 TATTTGGAATCAAGGAAAGTAGG + Intronic
1101086651 12:101243071-101243093 AATTTGGACTGGAGGTAAGGAGG - Intergenic
1101236072 12:102791744-102791766 TCTTTGGACTGGAGAAAGGAAGG + Intergenic
1101541215 12:105667161-105667183 TTGTTGGATTGGAAGAAAGTGGG - Intergenic
1102556470 12:113729952-113729974 TATTTGGGAGGGAAGAAAGTGGG - Intergenic
1103442494 12:120973791-120973813 TAAATGCACTGGAGGAAAGAGGG + Intergenic
1107099517 13:36574738-36574760 CATTTGGTATGGAAGAAAGTAGG - Intergenic
1107191829 13:37597275-37597297 CATTTGGGCTGGAGGATAGAGGG + Exonic
1110030911 13:70612061-70612083 TATGTGAACTAGAGAAAAGTAGG - Intergenic
1111973658 13:94943402-94943424 TATTTGGACTAGAATAAAATAGG + Intergenic
1115634056 14:35274108-35274130 TATTTGGATTGGAGAAGAGGGGG + Exonic
1116505282 14:45670096-45670118 TACTTTTACTGGAGGAAAGTAGG + Intergenic
1119059025 14:71455358-71455380 TATTTGGACTAGGAGAAAGGAGG + Intronic
1126538171 15:49791450-49791472 TGTCTGTACTGGAGGAAATTTGG + Intergenic
1127463225 15:59218990-59219012 TATTTGGGCTGGAGGCAAAAGGG + Intronic
1130866379 15:87936419-87936441 TATTTGGATGGAAGGAAAATAGG + Intronic
1131478984 15:92766232-92766254 TATTAGGACAGGAGGAAATGAGG - Intronic
1133501664 16:6372689-6372711 TCTTTGGATAGGAGGATAGTTGG + Intronic
1133686877 16:8173681-8173703 TATTTACATGGGAGGAAAGTTGG - Intergenic
1135860812 16:26054378-26054400 TAATTCGAATGGAGGAGAGTTGG - Intronic
1135970698 16:27070121-27070143 GACTTTGTCTGGAGGAAAGTAGG - Intergenic
1137819914 16:51434450-51434472 GAGTTGGATTGGAGGAAAGGGGG + Intergenic
1139102138 16:63781062-63781084 AATTTGGCTTGGAGGAAAGTAGG + Intergenic
1140143808 16:72285950-72285972 TATTTGGATTGGCCGGAAGTTGG - Intergenic
1141186353 16:81790263-81790285 GGTTTGGACTGGAGGGGAGTAGG + Intronic
1142837921 17:2602941-2602963 TATGTGGACTATAGGAAAGAGGG - Intronic
1143016074 17:3892014-3892036 TGTATGTACTGGAGGAAAGAGGG + Intronic
1144416031 17:15048139-15048161 TAATGGAACTGGAGGAAAGGAGG - Intergenic
1146521548 17:33529260-33529282 TGATTGGACTGGAGTGAAGTGGG - Intronic
1148666838 17:49381343-49381365 TATTTGATCTGGAAGATAGTAGG + Intronic
1148741584 17:49896364-49896386 TATTTGGAAGGGAGGAATGCAGG - Intergenic
1150557515 17:66267817-66267839 TACTTGGATGGGAGAAAAGTGGG + Intergenic
1150631233 17:66881822-66881844 AAATGGGCCTGGAGGAAAGTGGG + Intronic
1151053727 17:71008193-71008215 CATTTAAACTGGTGGAAAGTTGG - Intergenic
1151426253 17:74032799-74032821 TGGTTGAACTGGAGGGAAGTCGG - Intergenic
1153434617 18:5056192-5056214 CATTTGTACTGGGGGTAAGTAGG + Intergenic
1157236213 18:45967414-45967436 CATTTGCACTGGAGGAAGGCAGG + Intergenic
1157804124 18:50645427-50645449 TGTTCGGACTGGAGGAGAGATGG + Intronic
1157996529 18:52564042-52564064 AATTTGAACTGGATGAAAATTGG - Intronic
1167702748 19:51060196-51060218 TATTTGGAGATGAGGAAGGTAGG - Intronic
1168562649 19:57396674-57396696 GATTTGGTCAGGAGGAAAATTGG + Intronic
1168668552 19:58223475-58223497 TATCTGGAGTGGAAAAAAGTTGG - Intergenic
925474699 2:4200073-4200095 TTTTGGGTATGGAGGAAAGTGGG + Intergenic
928283978 2:29972930-29972952 TATTTTAACTGGTGGAAAGGGGG - Intergenic
928785875 2:34885487-34885509 TAGAGGGAATGGAGGAAAGTGGG - Intergenic
929175592 2:38972254-38972276 GATTTGAACTGGAGGTAAGGGGG + Intronic
930656167 2:54009183-54009205 TTTGAGGACTCGAGGAAAGTAGG + Intronic
930973603 2:57426843-57426865 TATATGGACTGGAGAGATGTTGG + Intergenic
931836998 2:66109478-66109500 TCTTTGGACTGGAGGGAAAATGG + Intergenic
932237456 2:70132088-70132110 TATTTAGGGTGGGGGAAAGTGGG + Intergenic
934024609 2:87990705-87990727 CATCTAGACTGGAGTAAAGTGGG - Intergenic
935097939 2:99964862-99964884 TATTAGCACTGGAGGAAAATGGG + Intronic
935475143 2:103510507-103510529 TATATTGAATGGAGAAAAGTTGG - Intergenic
935723786 2:106004679-106004701 GAATTACACTGGAGGAAAGTTGG - Intergenic
936292852 2:111239732-111239754 GAGTTAGAGTGGAGGAAAGTGGG + Intergenic
936603329 2:113922097-113922119 TAGTTGGGCTAGATGAAAGTAGG + Intronic
937880168 2:126858756-126858778 TGTTTGGGCTGGAGGAAGGGAGG - Intergenic
938066171 2:128283130-128283152 TTTTTCAACTGCAGGAAAGTGGG - Intronic
938764232 2:134449795-134449817 GATTTGGACAGGAGTGAAGTCGG + Exonic
939785916 2:146512382-146512404 TGTTTGGATTGGAGGGCAGTAGG - Intergenic
939785991 2:146513871-146513893 TGCTTGGACTAGATGAAAGTGGG + Intergenic
940613789 2:156025243-156025265 TATTTGGATTAGGGGAAAGAAGG + Intergenic
940684955 2:156836987-156837009 TACTTGGAGTGAAAGAAAGTGGG - Intergenic
941571945 2:167181628-167181650 TATTTGTTCTGGAGGAAAAAAGG - Intronic
941632155 2:167896389-167896411 TATTTGGACTCGAGTAGAATGGG + Intergenic
942809597 2:179982183-179982205 GATTTAGACTGGGGGCAAGTCGG + Intronic
943505596 2:188753004-188753026 TATTTGTTGTGGAGGAAAGCTGG - Intronic
945020309 2:205564404-205564426 TATTTTGGCTGGAAGGAAGTGGG - Intronic
945032201 2:205676136-205676158 GCTTTGGACTAGAGGAAAGAGGG + Intergenic
946309451 2:218874671-218874693 TATTTGGACTGGAGGAAAGTTGG - Intergenic
948109740 2:235445079-235445101 CATTTTGTCTGGAGGAAAGAGGG - Intergenic
1169627544 20:7589201-7589223 TCTTTGGATTTAAGGAAAGTAGG - Intergenic
1169682623 20:8232766-8232788 GTTTTGGACTGGAGGAAAGATGG + Intronic
1169829408 20:9807286-9807308 CATTTGAAATGGAGGAAACTAGG - Intronic
1170066843 20:12320300-12320322 GATGGGGACAGGAGGAAAGTGGG + Intergenic
1171021841 20:21591752-21591774 TAATTGGACTGGGGGAAAAAAGG - Intergenic
1172071658 20:32261740-32261762 TATTTGACCAGTAGGAAAGTGGG - Intergenic
1173393936 20:42660606-42660628 TGTGTGCACTGGAGAAAAGTTGG - Intronic
1173630152 20:44507054-44507076 TATATGGAGTGGAAGAAAATTGG - Intronic
1174568313 20:51483145-51483167 TGTTTGTAATGGGGGAAAGTTGG - Intronic
1174657594 20:52184554-52184576 GCTTTGGAAAGGAGGAAAGTTGG - Intronic
1174672605 20:52322084-52322106 AATTCTGACTGGAGGAAAGCTGG + Intergenic
1176793055 21:13343260-13343282 TATTTATAATGGAGGAATGTGGG - Intergenic
1177667982 21:24186428-24186450 TAATAGTACTGGAGGAAACTGGG + Intergenic
1178013006 21:28308190-28308212 TATTTGGTGTGGAGGAAGGCAGG + Intergenic
1178221064 21:30660774-30660796 ACTAAGGACTGGAGGAAAGTGGG + Intergenic
1179124577 21:38579556-38579578 CATGAGGACTGGAGGAAAGAGGG + Intronic
1179390210 21:40981858-40981880 TAGTAGGACTGGAGGTAAATTGG - Intergenic
1179659786 21:42866895-42866917 TAGTTGAACTGCAGGACAGTGGG - Intronic
1181142719 22:20818841-20818863 TATTTTGCCTGGAAGACAGTTGG - Intronic
1185085430 22:48738212-48738234 TATTGTCACTGGAGGAAAGGAGG + Intronic
949201609 3:1387252-1387274 TGGGTGGACTGGAGGAAATTTGG - Intronic
949856006 3:8461977-8461999 TGTTTGAACTGGAGGAGAGGTGG - Intergenic
950750098 3:15121711-15121733 TATTTTGTCTGGAGGCAACTGGG + Intergenic
951471905 3:23065569-23065591 TGTTTGAAATGGAGGAAATTGGG + Intergenic
952008857 3:28875998-28876020 TATTTCGAGTGTAGGAAATTAGG + Intergenic
956137555 3:66114109-66114131 TGGTTGGACTGGTGGAAGGTAGG - Intergenic
956192937 3:66624251-66624273 TGTTTCCACTGGAGGAAACTAGG - Intergenic
956626955 3:71275915-71275937 TAATTAGACTGGAGGAAAACAGG - Intronic
957621132 3:82594713-82594735 TCTGTGGTCTGGAGGAAGGTGGG + Intergenic
958513372 3:95078647-95078669 TATTTTGATTGGAGGAGAGAAGG + Intergenic
960001771 3:112739840-112739862 TCTTTGAACTTGAGGAAAGCTGG - Intergenic
961129601 3:124453632-124453654 CTTTTGGACTGGAGGAAAGTGGG - Intronic
961385393 3:126520443-126520465 TCTTAGCACTGGGGGAAAGTGGG + Intergenic
964920896 3:161893947-161893969 TATTTGCCCTGGAGCTAAGTAGG - Intergenic
965932691 3:174066151-174066173 TATTTGTATTGTGGGAAAGTTGG - Intronic
966212019 3:177463417-177463439 TATTTGGTGAGGAGGAAAATTGG - Intergenic
967523836 3:190469270-190469292 TATTTGGTCTGGAGGAACTAAGG + Intergenic
970457034 4:16234601-16234623 CATTTTGACTTGAGGAGAGTGGG + Intergenic
971151539 4:24038012-24038034 TAATTGTGCTGGAAGAAAGTGGG - Intergenic
971744175 4:30557984-30558006 TATTTGTATTGGAGGACAATGGG - Intergenic
972047782 4:34690501-34690523 GATTTTAACTGGAAGAAAGTAGG + Intergenic
972125634 4:35761298-35761320 TAGTTGGAGTGGAGGAAGGAGGG - Intergenic
973304729 4:48633145-48633167 TCTTTGGGCTGGAAGGAAGTGGG - Intronic
973811180 4:54571716-54571738 TATTTAGACTGAAGGACAGAAGG + Intergenic
977059433 4:92238861-92238883 TATTAGGAGTGGTTGAAAGTTGG - Intergenic
977386970 4:96353397-96353419 TATTTACACTTGAGGAAAATTGG - Intergenic
979002109 4:115234918-115234940 TATTTGCACAGCAGGAAATTAGG + Intergenic
981450438 4:144890918-144890940 TATTTGGAGTGGATGAGAGGTGG - Intergenic
981523838 4:145692857-145692879 TATTTGGATTCAAGGAAACTGGG + Intronic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
986135121 5:4969734-4969756 TATTTCTACTGAAGGAAAGAAGG + Intergenic
987054425 5:14177783-14177805 TATATGGACTGCAGGAAGGAGGG + Intronic
987476878 5:18401479-18401501 TTTTTGGCCTGGAGGCAAGAGGG - Intergenic
987960991 5:24808593-24808615 CTTTTGGAGTGGAGGAAAGGTGG - Intergenic
988627354 5:32891868-32891890 TGTTTGGAGTGGAGGAAAGTGGG - Intergenic
989342184 5:40388410-40388432 CAGCTGGACTGGAGCAAAGTAGG - Intergenic
994859934 5:105178383-105178405 TATTTGTTCTTGAGGAAAGCAGG - Intergenic
997119441 5:131158925-131158947 AATTTGGAAGGGATGAAAGTAGG - Intergenic
1006168730 6:32081112-32081134 TGTTTGGAATGGGGGAAAATAGG + Intronic
1006605039 6:35250008-35250030 TGTTTGGAGTGGAAGAAAATCGG + Exonic
1006922349 6:37635130-37635152 TAATTGGACTGGAGCGCAGTCGG - Exonic
1011092161 6:83615639-83615661 TATTTGGAATGATGGATAGTAGG - Intronic
1011159654 6:84374658-84374680 TATTTAGAGTGGAGGAAACATGG - Intergenic
1011342406 6:86331428-86331450 TATTAGGAGGGGAGGAAAGAGGG + Intergenic
1011842424 6:91518202-91518224 TATTTGTAATGAAAGAAAGTAGG + Intergenic
1012141789 6:95634740-95634762 TTTCTGGACTGGAGGAAAACAGG - Intergenic
1013711454 6:112904908-112904930 TGTTTGGTCTGGATGAAAGTAGG + Intergenic
1014533568 6:122589865-122589887 TATTTGAACTTGAAGAAAATTGG - Intronic
1015037110 6:128669216-128669238 TATGTGGTCTGGAGGAAAGTAGG - Intergenic
1015703970 6:136067295-136067317 TATTTGGTTTGGAGAAAAATGGG - Intronic
1016327511 6:142920030-142920052 TATTTCTACAGTAGGAAAGTTGG + Intronic
1018849509 6:167576910-167576932 TATTTGCACCGCAGGAAATTTGG + Intergenic
1022568401 7:31426784-31426806 TCTTTGGAGTGTAGGAAACTTGG + Intergenic
1022609340 7:31853650-31853672 TATTTGGACAGGAGGAGAGAAGG + Intronic
1022760625 7:33345624-33345646 TGATTGGACTGGGGGAAAGGAGG - Intronic
1023693341 7:42816951-42816973 TATTCAGACTGGAAGAAAGAAGG + Intergenic
1024084187 7:45880309-45880331 TATTTGTAATGAAGAAAAGTTGG + Intergenic
1024232943 7:47376640-47376662 TTTTTGGAGTGGAGGGAGGTTGG - Intronic
1028389894 7:90303407-90303429 TATATGGAATGGAGAAAAGCTGG - Intronic
1028674222 7:93440392-93440414 TCTTTGGATGGGAGGAAAATGGG - Intronic
1029025058 7:97407660-97407682 TATTTCCAATGGAGAAAAGTTGG - Intergenic
1029353079 7:100029458-100029480 TCCTTGGACTGGAGGAAATTAGG + Intronic
1030519663 7:110582195-110582217 TATTTGGTATTTAGGAAAGTTGG - Intergenic
1032896353 7:136255140-136255162 TAATTAGACTGGAAGAGAGTTGG + Intergenic
1035851023 8:2919362-2919384 CATTTTGACTGAAGGAAAGAAGG - Intergenic
1038813566 8:30877721-30877743 TGTTTCCACTGGAGGAAACTGGG - Intronic
1040559659 8:48513381-48513403 TATTTGGTCTGTAGGAGAGGAGG + Intergenic
1040733890 8:50482841-50482863 TATTTAGTTTGGAGGAGAGTTGG + Intronic
1040864248 8:52032198-52032220 TTTTAGGGCTGGAGAAAAGTGGG + Intergenic
1041239186 8:55834427-55834449 AATTGGGACTGGAGTAAATTGGG - Intergenic
1043371751 8:79602587-79602609 TATATGGAATTGGGGAAAGTAGG - Intergenic
1044619673 8:94176573-94176595 TACTTTGACTGGAGAAACGTGGG + Exonic
1046044682 8:108949642-108949664 TATTTGGGCTGGAGGGTAGTGGG - Intergenic
1047147846 8:122225300-122225322 TATTTTGACTGAAAGAAAATAGG - Intergenic
1051173854 9:14345247-14345269 TATTGGGACAGGAGGAAGCTAGG - Intronic
1051493544 9:17693992-17694014 TATTAGGCATGGAAGAAAGTAGG - Intronic
1051906339 9:22099117-22099139 TATTTAGCCAGGAGGAAAGGGGG + Intergenic
1053551053 9:39079822-39079844 TGTTGGGAATGGGGGAAAGTTGG - Intronic
1053815163 9:41899903-41899925 TGTTGGGAATGGGGGAAAGTTGG - Intronic
1054615433 9:67287538-67287560 TGTTGGGAATGGGGGAAAGTTGG + Intergenic
1055637625 9:78294390-78294412 TTGTTGAACTGGAGGAAATTTGG + Intergenic
1055773364 9:79740937-79740959 GATTTGGACAGGAGGATATTTGG - Intergenic
1056590615 9:87963546-87963568 TGGTAGGACTGGAGGAAACTGGG - Intergenic
1056914657 9:90735595-90735617 GATTGGGACAGGAGGAAAGTGGG + Intergenic
1058076814 9:100659728-100659750 TATTTGGAATGAATAAAAGTGGG + Intergenic
1058469020 9:105257891-105257913 TATTTGAAGGGGAGGAAAATGGG + Intronic
1060707924 9:125823768-125823790 TGTTTTGACTAGAGAAAAGTAGG + Intronic
1061515183 9:131085657-131085679 TCTTGGCACTGGAGGAAAGAGGG - Exonic
1186661685 X:11674341-11674363 GATTTAGCCTGGAGGAAAGAAGG - Intergenic
1187350814 X:18515229-18515251 AATTAGAACTTGAGGAAAGTGGG + Intronic
1187721492 X:22155409-22155431 TATTTAAACAGGAGGCAAGTTGG - Intronic
1187899342 X:24012625-24012647 TATATGGACTGGAGTAAGGATGG - Intronic
1188900007 X:35720805-35720827 TATTAGAACAGGAGCAAAGTAGG - Intergenic
1190746722 X:53328012-53328034 TATTTGGCCTAGAGGAGAGCAGG + Intergenic
1191151405 X:57223806-57223828 TTGTTGGACTGGATGAATGTTGG - Intergenic
1194188997 X:90811252-90811274 TTTTTTGCCTGGAAGAAAGTAGG - Intergenic
1195055183 X:101137687-101137709 TATTTTGCCTGGAGGAAAAAAGG + Intronic
1195849774 X:109270590-109270612 TATTTTTACTGGAAGAAAGCTGG - Intergenic
1196693614 X:118587076-118587098 TATTTATATTGGAGGAAAATTGG + Intronic
1198465649 X:136902485-136902507 TATTTAGATTGGGGGAAATTGGG + Intergenic
1198602505 X:138299262-138299284 CATTTGGCCTTGTGGAAAGTTGG + Intergenic
1199431595 X:147767260-147767282 TGTTGCCACTGGAGGAAAGTGGG - Intergenic
1199793584 X:151176263-151176285 TGTTTGCACTGGAGGAGAGAGGG + Intergenic
1200535578 Y:4393153-4393175 TTTTTTGCCTGGAAGAAAGTAGG - Intergenic