ID: 946311010

View in Genome Browser
Species Human (GRCh38)
Location 2:218882628-218882650
Sequence CTGTGTAGGCTGAGGGTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 416
Summary {0: 1, 1: 1, 2: 2, 3: 27, 4: 385}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946311002_946311010 20 Left 946311002 2:218882585-218882607 CCATGGGGGCAGAGAAATTGGGC 0: 1
1: 0
2: 0
3: 7
4: 194
Right 946311010 2:218882628-218882650 CTGTGTAGGCTGAGGGTGGCAGG 0: 1
1: 1
2: 2
3: 27
4: 385

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946311010 Original CRISPR CTGTGTAGGCTGAGGGTGGC AGG Intronic
900624407 1:3601584-3601606 CTGGGCAGGCTGAGGGGGCCAGG - Intronic
901202327 1:7473701-7473723 CTCTGTTGGCTGGGGGTGCCTGG - Intronic
901453140 1:9348408-9348430 CTCTGAAGGCTGAGGGAGCCTGG - Intronic
901625210 1:10620374-10620396 CTCGGGAGGCTGAGGGTGGTGGG + Intronic
901776941 1:11566595-11566617 CTGTGCTGGCGGAGGGAGGCTGG - Intergenic
901813179 1:11779142-11779164 CTGTGAAGGCCAAGGGTGGAAGG - Intronic
902335707 1:15753498-15753520 CTGTGAAGGCTGGGAGTTGCTGG - Intergenic
902979690 1:20113907-20113929 CTGTGTCCTCTGAGGGTGGATGG - Exonic
903071452 1:20728875-20728897 CTGTTTGGGCTGAGTGAGGCAGG - Intronic
904592300 1:31621628-31621650 CTGTGTGGGCTGGGGGTGGGAGG + Intronic
904882124 1:33708707-33708729 CTGGGTAGGCTGAGGTGGGAGGG - Intronic
905876653 1:41435884-41435906 CTGTGTGGGCTGAGGGTGGCAGG - Intergenic
907309412 1:53530730-53530752 CTGTGAGGGCTGAGGGAGGTTGG - Intronic
907309421 1:53530760-53530782 CTTTGAAGGCTGAGGGAGGTTGG - Intronic
910359830 1:86404531-86404553 ATTTCTAGGCTGAGGGTGGAGGG + Intergenic
911101513 1:94099315-94099337 CTCTGGAGGCTGAAGGAGGCAGG + Intronic
912380011 1:109242319-109242341 ATGTGTATGCTGGGGGTGGGTGG - Intergenic
912550955 1:110484988-110485010 CCGTGTGGGCAGAGAGTGGCTGG - Intergenic
912551917 1:110490243-110490265 TGGTATAGGCGGAGGGTGGCAGG - Intergenic
913105928 1:115613930-115613952 AGGTGGAGGCTGAGGGTGGGAGG - Intergenic
913106155 1:115615912-115615934 CTGTGTATGGTGGGGGTGGATGG + Intergenic
913195847 1:116455344-116455366 ATCTGTATGCTGAGGGTGGGCGG - Intergenic
913229667 1:116731325-116731347 CTGTGAAGGCTGAGGGAGAAAGG - Intergenic
913478729 1:119264061-119264083 CAGTTTTGGCTGAGGGTGGGGGG - Intergenic
913478767 1:119264435-119264457 CAGTTTTGGCTGAGGGTGGGGGG + Intergenic
913486663 1:119337826-119337848 CTGTGTTGGTTGAAGGTGGGTGG + Intergenic
914878426 1:151529587-151529609 AGGTGGAGGCTGAGGGTGTCTGG + Intronic
915410413 1:155697328-155697350 CTGTGTAGGTTTAGGGAGACCGG + Intronic
916073076 1:161183067-161183089 CAGTGTAGGCTGAGGGGAGTTGG - Intergenic
916573697 1:166048981-166049003 CTGTAGAGGCTCAGTGTGGCTGG - Intergenic
917734520 1:177908317-177908339 CCGTGTAGCCTGAGGATGGTAGG - Intergenic
920957836 1:210635389-210635411 CTTAGTAGGCTGAGAGAGGCAGG + Intronic
921291045 1:213657990-213658012 CTGTGAGGGCTGAGGGGTGCAGG + Intergenic
922089866 1:222385766-222385788 CTCTTTTGGCTGAGGGTGGTGGG - Intergenic
922220889 1:223557677-223557699 ATGTGTAGTCTGAGGGGTGCTGG - Intronic
922501031 1:226096993-226097015 CTGTGTGGGGTGGGGGTGTCGGG + Intergenic
922892123 1:229070168-229070190 GTGTATGGGCTGATGGTGGCTGG - Intergenic
923401112 1:233615664-233615686 CTGTAAAGGTTGAGGGTGGGGGG - Intronic
924765858 1:247031807-247031829 CTTGGGAGGCTGAGGCTGGCGGG - Intergenic
1063153167 10:3355125-3355147 CTCTGAAGGCAGGGGGTGGCTGG - Intergenic
1065516224 10:26527050-26527072 CTTGGTGGGCTGAGGGAGGCTGG - Intronic
1065628610 10:27655188-27655210 CATTGGAGGCTGAGGGTGGGAGG + Intergenic
1066468177 10:35671379-35671401 CTGGGGAGGCTGAGGCGGGCAGG + Intergenic
1067396451 10:45924512-45924534 CTTGGGAGGCTGAGGGTGACAGG - Intergenic
1067556458 10:47276721-47276743 TTGTGCAGTCAGAGGGTGGCAGG - Intergenic
1067580111 10:47439421-47439443 CTGTGTAGGATGAGGGAGTTAGG + Intergenic
1067864773 10:49893620-49893642 CTTGGGAGGCTGAGGGTGACAGG - Intronic
1068131160 10:52896929-52896951 CTGCTTAAGCTGAGGGTGACAGG + Intergenic
1070553814 10:77513098-77513120 CTGGGTAGGGGGAGGCTGGCAGG - Intronic
1070946431 10:80395701-80395723 CTGTGCATACTCAGGGTGGCTGG - Intergenic
1071504453 10:86224169-86224191 CTGTGTATGCTGGGAGTGTCGGG - Intronic
1071548556 10:86547740-86547762 CTAGGGAGGCTGAGGGTGGCAGG + Intergenic
1072003410 10:91220133-91220155 TTGTGGAGGTTGAGGGTGGGGGG - Exonic
1073063765 10:100746617-100746639 CTGACTAGGGAGAGGGTGGCTGG - Intronic
1073114430 10:101083324-101083346 CTGGGCAGGCTGTGGGTGGAGGG - Intergenic
1073214727 10:101829864-101829886 CTGTGGGGGCGGAGGGAGGCTGG + Exonic
1073804479 10:107082587-107082609 CTTTGGAGGCTGAGTGAGGCAGG - Intronic
1074206118 10:111284363-111284385 CTGAGCAGGCTGAGGAAGGCTGG - Intergenic
1074382224 10:112990597-112990619 CTGGGGAGGCTGAGGTGGGCGGG + Intronic
1076100575 10:127774435-127774457 CTGCGTGGGCTGAGTGGGGCTGG - Intergenic
1076481901 10:130790244-130790266 ATGTGTGGGTTGAGGGTGGTGGG - Intergenic
1076481908 10:130790296-130790318 ATGTGTGGGTTGAGGGTGGTGGG - Intergenic
1076481921 10:130790400-130790422 ATGTGTGGGTTGAGGGTGGTGGG - Intergenic
1076529349 10:131134135-131134157 CTGGGTAGGCTGGGGGTGGCAGG + Intronic
1076638042 10:131895579-131895601 CTGACTAGGCTGAGGCTCGCAGG + Intergenic
1077017688 11:404222-404244 CTGTCGGGGCTGAGGGTGGAGGG - Exonic
1077155486 11:1089148-1089170 CTGGGGAGGCAGAGGGAGGCCGG - Intergenic
1077540860 11:3145906-3145928 CTGGGTGGGCTGAGGGTTACAGG + Intronic
1078731587 11:13979874-13979896 CTCTCTAGGGTGAGGGTGGGTGG - Intronic
1078955996 11:16195879-16195901 ATATGTAGGCTGAGGCTGTCAGG + Intronic
1082820109 11:57538855-57538877 CTGTGAATGCTGGGGGTGGGTGG + Intergenic
1082874364 11:57972825-57972847 CTGTGTATGCTGAGGGGAGTGGG + Intergenic
1083579830 11:63817971-63817993 CTGTGTCGGCCGAGGGTGCCCGG - Exonic
1083880445 11:65545845-65545867 CTATGGGGGCTGAGGCTGGCCGG - Intronic
1084322298 11:68380347-68380369 CTGTGTTGACTGAGGCAGGCTGG + Intronic
1087282921 11:96232433-96232455 CTGGGTAGGATGTGGGTGGGTGG + Intronic
1089335998 11:117724402-117724424 CTGTGGAAGGTGAGGGTGGGAGG + Intronic
1091298465 11:134489704-134489726 CTGTGTGGCCTGAGGTTGTCAGG - Intergenic
1091346330 11:134856753-134856775 CAGTGCAGGCAGAGCGTGGCTGG + Intergenic
1091763221 12:3101514-3101536 GTGTGTAGGCTGGGGATGGGAGG - Intronic
1094687536 12:32732986-32733008 CTGGGGAGGCTGAGGCAGGCAGG + Intronic
1095384267 12:41631693-41631715 CTGTGTAAGCTGAGGTGGGATGG + Intergenic
1096174330 12:49502557-49502579 CTAGGGAGGCTGAGGGTGGGAGG - Intronic
1096737145 12:53664477-53664499 CTCTTTTGGCTGAGGGTGGATGG + Intronic
1097261945 12:57725390-57725412 CTGGGTTGGCTGAGGGAGGCAGG + Intronic
1097723783 12:63051520-63051542 CTGTGTGGCGTGACGGTGGCTGG + Intergenic
1098563927 12:71909730-71909752 CAGTGTAGGCAGTGGGGGGCAGG - Intronic
1099789687 12:87317320-87317342 CTCTGTAGGCAGAGGGTGCGGGG + Intergenic
1102312547 12:111858004-111858026 CTGGGTAGGCTGAGGTAGGAGGG - Intronic
1103201880 12:119094509-119094531 CAGTGAAGGTGGAGGGTGGCAGG - Intronic
1103341236 12:120222328-120222350 TTGTGCAGGCTGAGGGCGCCTGG - Intronic
1103524220 12:121557028-121557050 CTGGGTAGGCTGAGGAGGGGAGG - Intronic
1103892625 12:124251178-124251200 CTCTGGAGGCTGAGTGAGGCAGG + Intronic
1103905686 12:124326266-124326288 CTGAGGAGACAGAGGGTGGCCGG + Exonic
1104159495 12:126164751-126164773 CTGTCTAGGCCTAGGGTGGGTGG + Intergenic
1104685881 12:130783617-130783639 AAGAGGAGGCTGAGGGTGGCGGG + Intergenic
1104981513 12:132574982-132575004 CTGGGAAGGCTGAGGAAGGCGGG + Intronic
1107103111 13:36615004-36615026 TTATATAGGCTGACGGTGGCTGG + Intergenic
1107950355 13:45455744-45455766 CTATATAGGCTGTGGGAGGCTGG - Intergenic
1108330102 13:49377634-49377656 CTCGGGAGGCTGAGGTTGGCGGG - Intronic
1110053932 13:70940834-70940856 CTTTGAAGGCTGAGGGTGGGAGG + Intergenic
1111197012 13:84888188-84888210 ATGTGTTGGATGGGGGTGGCAGG + Intergenic
1111831392 13:93334572-93334594 CTTGGTAGGCTGAGTGAGGCAGG - Intronic
1111991723 13:95123602-95123624 CTTTGGAGGCTGAGGTGGGCAGG - Intronic
1112177219 13:97038001-97038023 CTCTGGAGGCTGAGGCAGGCAGG - Intergenic
1112417760 13:99217701-99217723 CTGTGGAGGTTGTGGGGGGCAGG + Intronic
1112890220 13:104220256-104220278 CTGTGTAGGCTGGGGGGAGGGGG + Intergenic
1113432447 13:110262318-110262340 CTGGGAAGGCTGATGGTGGAGGG - Intronic
1115501323 14:34052596-34052618 GTGTGTTGGCTGGGGGTGGTGGG - Intronic
1117352048 14:54890899-54890921 CTGTGTAGTCAGAGGGAAGCTGG - Intronic
1117403070 14:55375428-55375450 CTGTGGAGGCTGAGGTGGGAGGG - Intronic
1118303588 14:64636222-64636244 ATGTGAAGGCTGTGGGTGGGAGG + Intergenic
1118353530 14:64991700-64991722 CTGTGTGGGCTGAGGTGGTCAGG + Intronic
1118822685 14:69355406-69355428 CTGAGTAGGCGGTGGGTGGTGGG - Exonic
1118825029 14:69372175-69372197 TTGTCTAGGCAGAAGGTGGCTGG + Intergenic
1121015061 14:90544073-90544095 CTGTGGAGGCTCAGAGTGGAAGG + Intronic
1121182764 14:91942040-91942062 CTGAGCAGGCTGAGGGCTGCAGG - Intronic
1122122288 14:99561009-99561031 CTGTGGAGACTGAGGGAGGCAGG - Intronic
1122232624 14:100314287-100314309 CTGTGCAAACGGAGGGTGGCAGG + Intergenic
1122302537 14:100739155-100739177 CTGTGAGGGCTGAGGGTGGAAGG - Intergenic
1122371800 14:101233199-101233221 CTGGGTGGGCTTAGGGAGGCGGG - Intergenic
1122546323 14:102524660-102524682 CTGTGAAGCCTGAGACTGGCCGG + Intergenic
1122573873 14:102728390-102728412 CTGTGTACACCGAGGGCGGCAGG + Exonic
1122884611 14:104705477-104705499 CAGTGTGGGCTGAAGGGGGCCGG + Intronic
1122953060 14:105056508-105056530 CTGTGCAGGCTGAGGTGGGAGGG - Intronic
1122996471 14:105267972-105267994 CCATGGAGGCTGAGGCTGGCAGG + Intronic
1125518862 15:40337447-40337469 CTGTGTAGACAGAGGGAGTCAGG + Intronic
1126876378 15:53045945-53045967 CTTGGGAGGCTGAGGGAGGCAGG - Intergenic
1127480621 15:59373524-59373546 ATGTGTTGGCTGAGGTTGGATGG - Intronic
1127652715 15:61024691-61024713 CTTTGGAGGCTGAGGTGGGCAGG - Intronic
1127894423 15:63283335-63283357 CTCAGGAGGCTGAGGGTGGGAGG - Intronic
1128423755 15:67519744-67519766 CTTGGGAGGCTGAGGGTGGGAGG + Intergenic
1128794189 15:70452786-70452808 CTGAGGAGGCTGAGGTTGGGAGG - Intergenic
1128884878 15:71277451-71277473 CTGTTTAGGCTGAAGGCAGCTGG - Intronic
1129674073 15:77622915-77622937 CAGTGTGGGCAGAGGGTGGCCGG - Intronic
1130620807 15:85460430-85460452 CTGTCCAGGCTGGGGGTGACAGG - Intronic
1130971969 15:88740691-88740713 CTGAGTAGGCTGGGGTTGGAGGG - Intergenic
1131065985 15:89435481-89435503 CTGCCCAGGCTGTGGGTGGCTGG + Intergenic
1131116492 15:89799343-89799365 ATGGGTTGGCTGTGGGTGGCAGG + Intronic
1131514067 15:93065889-93065911 CTCTGTAGGCTGTTGCTGGCTGG + Intronic
1132712238 16:1274169-1274191 CTGTGTAGGCTGAGCATCCCAGG - Intergenic
1132959635 16:2614646-2614668 CCGTGAAGGCTGAGGGTTTCTGG + Intergenic
1132972696 16:2696621-2696643 CCGTGAAGGCTGAGGGTTTCTGG + Intronic
1132977083 16:2716268-2716290 CGGTGCAGGATGAGGGCGGCAGG - Intronic
1133378958 16:5313885-5313907 CTTTGGAGGCTGTGGGTGGGTGG + Intergenic
1135726571 16:24858657-24858679 CTGTGGAGGCTGAGGGCTGCTGG - Exonic
1135790458 16:25389512-25389534 TGGAGTAGGCTGAGGTTGGCAGG + Intergenic
1135814625 16:25621225-25621247 CTCTGTTTGCTAAGGGTGGCAGG + Intergenic
1136370240 16:29831563-29831585 GTGTGGAGGATGGGGGTGGCTGG - Intronic
1137759306 16:50927681-50927703 CTTGGGAGGCTGAGGGAGGCAGG - Intergenic
1137775134 16:51047933-51047955 CTGAGGGGGCTGAGGGAGGCTGG + Intergenic
1138203196 16:55105297-55105319 ATCCGTAGGCTGAGGGTGGGCGG - Intergenic
1138725676 16:59136136-59136158 CTGAGGAGGCTGAGGTTGGGAGG + Intergenic
1139018379 16:62717843-62717865 CAGGGTGGGGTGAGGGTGGCAGG + Intergenic
1140420721 16:74816822-74816844 CTGTGAGGCCTGAGGGTGGGAGG + Intergenic
1141616138 16:85210682-85210704 CTGTGTAAGTTGAGGCTGGGAGG + Intergenic
1141622110 16:85241871-85241893 CAGTGTGGGCTGGGGGTGCCCGG - Intergenic
1141859437 16:86706444-86706466 CTGTGAAGCCTGAGGGTGGCTGG + Intergenic
1141956270 16:87373638-87373660 CTCCGGAGGCTGAGGGAGGCTGG - Intronic
1143188392 17:5024025-5024047 CTGGGTAGGGTTGGGGTGGCTGG - Exonic
1143332342 17:6147004-6147026 CTAGGTTGGCTGGGGGTGGCTGG - Intergenic
1143370791 17:6437798-6437820 CTGTTTAGGGTGAGGGTGGTGGG - Intergenic
1143497904 17:7322906-7322928 TGGTCTGGGCTGAGGGTGGCAGG + Intronic
1144801062 17:17927770-17927792 CTCAGGAGGCTGAGGGTGGGAGG - Intronic
1146568359 17:33932459-33932481 TTGGGGAGGCTGAGGCTGGCGGG + Intronic
1148044420 17:44733947-44733969 ATGTGTAGCCAGAAGGTGGCAGG + Intronic
1148081661 17:44970367-44970389 CTGCGAGGGCTGTGGGTGGCGGG - Intergenic
1148485529 17:47988356-47988378 CTGTGGAGGCTGAGGTGGGAGGG + Intergenic
1149141815 17:53440274-53440296 CTGTGTATGGTGAGGGGGGATGG - Intergenic
1149623276 17:58061862-58061884 CTTTGCAGGCTGAGGGTAACTGG - Intergenic
1150229439 17:63542073-63542095 ATGTGCTGGCTGTGGGTGGCAGG - Intronic
1150976343 17:70091401-70091423 CTGTGTTGGAGGAGGGTAGCTGG - Intronic
1151538686 17:74753168-74753190 AGGTGGAGGCTGAGGGTTGCAGG - Intronic
1151892453 17:76958669-76958691 CTCTGAAGGCAGAGGGTGGGTGG + Intergenic
1152235812 17:79137816-79137838 CTGAGAAGGCAGAGTGTGGCTGG - Intronic
1152565354 17:81097869-81097891 CTGATGAGGCTGTGGGTGGCTGG - Intronic
1152847921 17:82613991-82614013 CTGTGGAGGTGGAGGGTGGCTGG - Intronic
1153344857 18:4014365-4014387 CTGTGAAGGATAAGGATGGCTGG - Intronic
1156121875 18:33854246-33854268 CTGTGGAGGTAGAGGGTGGAGGG - Intronic
1157378558 18:47189838-47189860 CTGTGAAGGCAGAGGGTTGAGGG + Intergenic
1157477279 18:48031423-48031445 CTATGTAGCCTAGGGGTGGCTGG - Intronic
1159390962 18:67791034-67791056 CTGTGTAGGCTGTGTGGGGGTGG + Intergenic
1161793781 19:6375284-6375306 CTGTGGTGGCTGAGGGTGCCCGG - Exonic
1162042842 19:7980783-7980805 CTGGGCAGGCTGGGGGTGGATGG + Intronic
1162380941 19:10331443-10331465 CTTTGGAGGCTGAGGCAGGCGGG + Intronic
1162940906 19:14008476-14008498 CTCTGGAGGCTGAGGCTGGCAGG + Intergenic
1163277406 19:16294031-16294053 CTTAGGAGGCTGAGGGTGGGAGG - Intergenic
1163290527 19:16376669-16376691 CTGTTGGGGGTGAGGGTGGCAGG - Intronic
1163560022 19:18013608-18013630 ATGTGGAGTCTGTGGGTGGCAGG + Exonic
1163632166 19:18423081-18423103 CAGAGTGGGCTGAGGGAGGCTGG + Intronic
1163758951 19:19122665-19122687 CTGTGAAGGCTGAGGTGGGAAGG + Intronic
1164851582 19:31488764-31488786 CTCTGGAGGCTGAGGTAGGCGGG - Intergenic
1165413670 19:35677919-35677941 CTGGGTGGGCTGGGGGTGGGGGG + Intronic
1165789373 19:38482377-38482399 TTGTGGAGGCAGAGGCTGGCTGG + Intronic
1166029638 19:40117422-40117444 CTCGGGAGGCTGAGGTTGGCGGG - Intergenic
1166732510 19:45067150-45067172 CTCTGTAGCCGGAGGGAGGCCGG + Intronic
1166758106 19:45206947-45206969 CTCTGGAGGCTGAGTGAGGCAGG - Intronic
925182732 2:1827451-1827473 CCTTCTAGGCAGAGGGTGGCGGG - Intronic
925438670 2:3865144-3865166 CTGTGTAGGCCCAGGGAAGCAGG - Intergenic
928162385 2:28939997-28940019 CTCGGGAGGCTGAGGGAGGCAGG + Intronic
929535712 2:42783133-42783155 CTTTGTTGGCTGATGGTGGAGGG - Intronic
930946144 2:57078371-57078393 CTGTGTAAGGAGAGGGGGGCGGG - Intergenic
930967178 2:57343574-57343596 CTTGGGAGGCTGAGGGTGGATGG + Intergenic
932129555 2:69175514-69175536 CTGGGGAGGCTGAGGCTGGAGGG + Intronic
932180211 2:69640258-69640280 CTCTGTAGGCTGTGGGTGTGGGG - Intronic
932415685 2:71572687-71572709 CTGTCTAGGCTTGGGGTTGCTGG + Intronic
933322265 2:80792018-80792040 ATGTGTATGCTTAGGGTGGGGGG - Intergenic
934676606 2:96253813-96253835 GTGTGTAAGCAGGGGGTGGCTGG + Exonic
934703321 2:96461034-96461056 CTCGGGAGGCTGAGGTTGGCAGG - Intergenic
934715660 2:96541914-96541936 CTCTGTGGGCTGAGTGGGGCTGG + Intronic
934715853 2:96542835-96542857 ATGTGTGAGCTGAGGGTAGCAGG + Intronic
934835845 2:97589443-97589465 CTTTGCAGGCTGAGGGCTGCGGG - Intronic
936116041 2:109704020-109704042 CTACCTAGGCTGAGGGTGGTGGG + Intergenic
936496613 2:113027877-113027899 CAGCCTAGGCTGTGGGTGGCTGG - Intronic
937251623 2:120527606-120527628 ATGTGCAGGCTGGGGGTGGTGGG + Intergenic
938006303 2:127789454-127789476 CTCGGGAGGCTGAGGTTGGCGGG + Intronic
938036048 2:128035834-128035856 CTCAGGAGGCTGAGGGTGGTGGG + Intergenic
938115867 2:128602662-128602684 CTGGGTGGGCTGAGTGTGCCTGG + Intergenic
939308351 2:140438122-140438144 CTCTGGAGGCTGAGGCTGGAGGG - Intronic
941382972 2:164818875-164818897 CTTAGTAGGCTGAGGTTGGGAGG - Intronic
944605743 2:201350140-201350162 CTTTGAAGGCTGAGGAGGGCTGG + Intronic
944781333 2:203021031-203021053 CTCGGGAGGCTGAGGGAGGCAGG - Intronic
946038734 2:216765899-216765921 CACTGCAGGCTGAGGGTGGGAGG + Intergenic
946311010 2:218882628-218882650 CTGTGTAGGCTGAGGGTGGCAGG + Intronic
947289391 2:228555268-228555290 CTGTGTTGGCTGTGGCTGACAGG + Intergenic
947640422 2:231704670-231704692 CTCAGGAGGCTGAGGGAGGCAGG + Intergenic
947746124 2:232508210-232508232 CTGGGTAGGCTGAGGGAGGAGGG + Intergenic
948246708 2:236492429-236492451 AAGTGTATGCTGAGGATGGCAGG - Intronic
1169127314 20:3138847-3138869 CTTTGTAGGCTGAAGGAAGCTGG - Intronic
1172873522 20:38150294-38150316 CTGTCTAGGCTGGGCTTGGCTGG - Intronic
1172888848 20:38249522-38249544 CTGTGTGGGCTACGGGTGGGAGG - Intronic
1172949579 20:38714258-38714280 CCTTGCAGGCTGAGGGTGGGGGG + Intergenic
1174849551 20:53979327-53979349 CTGGGTAGGGTGCTGGTGGCTGG + Intronic
1176185387 20:63775616-63775638 TTTTGAAGGCTGAGGGTTGCAGG - Intronic
1177067337 21:16456314-16456336 CTGTGGAGGTTGAGGGTGGGAGG - Intergenic
1177134321 21:17292846-17292868 CTCGGGAGGCTGAGGTTGGCGGG + Intergenic
1178109171 21:29353581-29353603 CTCTGTAGGCTGGAGGTGGGTGG - Intronic
1178446336 21:32647042-32647064 CTTTGTGGGGTGAGGGTTGCAGG - Intronic
1178882579 21:36461041-36461063 CTTTGTAGGCAGCTGGTGGCTGG + Exonic
1179510139 21:41867114-41867136 CTTTCTGGGCTGAGGGTGTCGGG - Intronic
1179524683 21:41967977-41967999 CTGTGGAGGGTCAGGGGGGCAGG - Intergenic
1179643694 21:42762656-42762678 CTGACTGGGCTGTGGGTGGCAGG - Intronic
1180063978 21:45403985-45404007 CTGGGAAGGCTGAGGCAGGCAGG + Intergenic
1180157715 21:45986209-45986231 GAGTGGAGGCTGAGGGTGGCAGG - Intronic
1180581565 22:16844179-16844201 CTCTGTAGGCAGAGGGAGGAGGG + Intergenic
1180898845 22:19356707-19356729 CTGGGTAGGCTGAGGGCTGAGGG - Intronic
1180972472 22:19822641-19822663 GTGTGCAGGCTGCAGGTGGCTGG - Intronic
1183457109 22:37928878-37928900 CTTTGGAGGCTGAGGCAGGCAGG + Intronic
1183545461 22:38452874-38452896 CAGTGTGGGGTGGGGGTGGCGGG - Intronic
1184301073 22:43561437-43561459 CAGTGGTGGCTGAGGGGGGCGGG - Intronic
1184431812 22:44445415-44445437 CTGTGTGGGCTGAGGTGGGAGGG + Intergenic
949509655 3:4757148-4757170 CTGGGTAGGCAGAGAGTGCCTGG - Intronic
952396206 3:32922598-32922620 CTGGGTAGGATGAGGCTGTCGGG + Intergenic
952810769 3:37400594-37400616 CTGTTTTGGCTGAGGCTGGCTGG + Intronic
953677968 3:45018026-45018048 CTGTGCCGGGTGAGGGTTGCGGG + Intronic
953679644 3:45029811-45029833 GTGTGTAAGTTGAGGGTGCCGGG - Intronic
953755958 3:45646135-45646157 TTGTGTAAGATGAGTGTGGCTGG - Intronic
954802728 3:53196462-53196484 CTCGGGAGGCTGAGGGTGGGAGG - Intergenic
955784933 3:62527439-62527461 CTGTGTGTGCTGGGGGTGGGGGG + Intronic
956094639 3:65703136-65703158 CTGTTTTGGCAGGGGGTGGCTGG + Intronic
956426977 3:69145963-69145985 CTCTGTGGGGTGAGGGTGGGGGG - Intergenic
960108722 3:113824862-113824884 CTGTGTAAGCAAAGGGTGACTGG + Intergenic
960517975 3:118623357-118623379 GTGTATATGTTGAGGGTGGCAGG + Intergenic
960996767 3:123345311-123345333 CTGTGTTGGCCGAGGCAGGCTGG + Intronic
961838187 3:129682512-129682534 CACTGTAGGCTCAGGGAGGCAGG - Intronic
962113197 3:132471999-132472021 CTCGGGAGGCTGAGGTTGGCGGG + Intronic
963168015 3:142225076-142225098 CTGTCCAGGCTGAGGGTGCCAGG - Intronic
963530212 3:146465552-146465574 TTGTGGAGGGTGAGTGTGGCGGG - Intronic
964527572 3:157631370-157631392 CCCTGTCAGCTGAGGGTGGCAGG - Intronic
965728172 3:171742331-171742353 CTCTGGAGGCTGAGGCAGGCAGG - Intronic
965757353 3:172040106-172040128 CTGGGAAGGCTGGGGGTGGGGGG - Intronic
966377517 3:179312090-179312112 CAATTTAGGCTGAGCGTGGCGGG - Intergenic
966882860 3:184359807-184359829 CAGCGGAGGCTGAGGATGGCTGG + Intronic
967843051 3:194022255-194022277 GTGTGTAGGATGTGGGTGGGGGG - Intergenic
968006571 3:195247244-195247266 CTGTGAAATCTGAGGGTGGTCGG + Intronic
968685411 4:1954735-1954757 GTGTGTGGGATGAGGGTGGCAGG + Intronic
968880291 4:3295058-3295080 CTGTTTAGGATGAGGGTCTCGGG + Intronic
968905791 4:3449956-3449978 CTGTGGGGGCTGAGGGAGGGAGG + Intergenic
968940574 4:3635405-3635427 CTGTGTTGACTGAGGATGGGAGG - Intergenic
971008509 4:22403631-22403653 CTCGGTAGGCTGAGGTTGGGAGG + Intronic
971217660 4:24675934-24675956 GTGGCTGGGCTGAGGGTGGCAGG - Intergenic
971537892 4:27777401-27777423 CTCTGAAGGCTGAGGGAGGAGGG + Intergenic
971594968 4:28515531-28515553 CTCCGGAGGCTGAGGCTGGCAGG + Intergenic
972323949 4:37997817-37997839 CAGAGTAGACTGAGGGTGGATGG + Intronic
973299307 4:48561906-48561928 CTCAGGAGGCTGAGGGTGGAGGG + Intronic
975072163 4:70155474-70155496 CTGGGTAGGCTGAGTGAGGCAGG - Intronic
976178755 4:82379879-82379901 CTTGGGAGGCTGAGGGTGGGAGG - Intergenic
976191217 4:82488993-82489015 CTGGGGAGGCTGAGGTGGGCTGG - Intronic
978318525 4:107466974-107466996 CTGTGGGGGCCGAGGGAGGCTGG - Intergenic
979942552 4:126779903-126779925 CAGTGGAGGGTCAGGGTGGCAGG - Intergenic
980053160 4:128057856-128057878 CTTGGGAGGCTGAGGCTGGCAGG + Intergenic
982636190 4:157899714-157899736 ATGTGTGGGCTGAGGGAGGAGGG + Intergenic
982855223 4:160373790-160373812 CTCTGTAGGCTGAGTATGACTGG + Intergenic
983334615 4:166375847-166375869 GTGGGTAGTCTGAAGGTGGCAGG + Intergenic
984708125 4:182862728-182862750 CAGGGAAGGCTGGGGGTGGCAGG - Intergenic
985373912 4:189314242-189314264 TTGTGAAGGCTTACGGTGGCTGG + Intergenic
985675570 5:1229768-1229790 CGGTGCAGGCTGGGGGTGGGGGG + Intronic
985771140 5:1812143-1812165 CTGTGTCTGGTGAGGGTGGAAGG + Intronic
985800636 5:2003538-2003560 CAGTGTAGGGTGAGGCTGGGAGG + Intergenic
985829216 5:2215618-2215640 CTGTGTTGGCAGAGGTGGGCAGG + Intergenic
992732278 5:79683810-79683832 CTTGGGAGGCTGAGGGAGGCAGG + Intronic
994570617 5:101508554-101508576 TTGAGTAGGCTGAAGGTGGGGGG - Intergenic
994902490 5:105793557-105793579 CTTGGTAGGCTGAGGTTGGGAGG - Intergenic
995512340 5:112921867-112921889 CTGCCCAGGCTGAGGGTCGCGGG - Intronic
995773269 5:115696020-115696042 CTTTGTAAGCTTAGGATGGCAGG - Intergenic
996900416 5:128537502-128537524 CGGAGGAGGCTGAGGCTGGCCGG + Exonic
997376731 5:133402912-133402934 CTGTCAAGGTTGATGGTGGCGGG + Intronic
997466352 5:134090580-134090602 GGGTGGAGGCTGAGGGTGGGAGG - Intergenic
997737495 5:136224783-136224805 CTGTGGAAGCAGAGGGTGGAGGG - Intronic
998742561 5:145221428-145221450 CTGTGAAGGATGAGGTTGGAAGG + Intergenic
1001507125 5:172288481-172288503 GTGTGTTGGCGGCGGGTGGCGGG - Intergenic
1003531566 6:6941402-6941424 CTTGGCAGGCTGAGGGAGGCTGG + Intergenic
1003536999 6:6983948-6983970 CTCGGGAGGCTGAGGGTGGGAGG + Intergenic
1004089629 6:12487855-12487877 CTATGTCGGCTCAGGGTTGCTGG - Intergenic
1004313401 6:14565477-14565499 CTGTTTTGGCTGGGGGTGGTAGG - Intergenic
1005207163 6:23418128-23418150 CTGGTTGGGCTGAGGGTGCCAGG - Intergenic
1006128654 6:31855120-31855142 CTCGGGAGGCTGAGGTTGGCGGG + Intergenic
1006373587 6:33659672-33659694 CTGTGGAGGTGGAGGGAGGCTGG - Intronic
1006799174 6:36748574-36748596 CTGTGTAGGCTGGGTGAGGTTGG + Intronic
1006801709 6:36764089-36764111 CAGTGTAGGCTCACGGTGGGGGG - Intronic
1006915849 6:37593433-37593455 CCGTGCAGGCTGAGGGTGTGTGG + Intergenic
1007662797 6:43496751-43496773 CTGTTTAGGTTGATGGGGGCGGG + Intronic
1007737038 6:43988141-43988163 CTGTTTTGGCTGAGGCAGGCTGG + Intergenic
1007966537 6:46008549-46008571 CTGTGAAAGCTGAAGGGGGCTGG - Intronic
1008590592 6:52989950-52989972 CTTGGGAGGCTGAGGGTGGCAGG - Intronic
1009287674 6:61842301-61842323 CTGTGTAGGCTGACAGGGCCTGG + Intronic
1009913988 6:69969804-69969826 CCAGGTTGGCTGAGGGTGGCTGG + Intronic
1010703503 6:79078525-79078547 CTGTGGAGGCCGATAGTGGCAGG + Intergenic
1014034921 6:116755393-116755415 CTGTGAAGGCTGAGAGAGGTGGG + Intronic
1014557267 6:122850061-122850083 CTCGGGAGGCTGAGGTTGGCGGG + Intergenic
1015759623 6:136644563-136644585 CTGTATTGACTGAAGGTGGCAGG + Intronic
1016548411 6:145249482-145249504 CAGTGGAGGATGAGGGTGGTAGG - Intergenic
1017669101 6:156752923-156752945 CTGGCAAGGCCGAGGGTGGCAGG + Intergenic
1018522687 6:164668829-164668851 GTGTGCTGGCTGAGGGTGGGTGG + Intergenic
1019326233 7:439635-439657 CTGCGTACCTTGAGGGTGGCAGG - Intergenic
1019438967 7:1037487-1037509 CTCGGGAGGCTGAGGTTGGCGGG - Intronic
1019442745 7:1055693-1055715 CTCTGTGGGGTGAAGGTGGCCGG + Intronic
1020340216 7:7101893-7101915 CTGAGTAGGCAGAGGGAGGTTGG - Intergenic
1020587156 7:10083123-10083145 GTCTGTAAGCTGTGGGTGGCAGG - Intergenic
1021083218 7:16388089-16388111 CTTGGGAGGCTGAGGCTGGCAGG - Intronic
1021819981 7:24487199-24487221 TGGTGGAGGCTGAGGGTGGAGGG - Intergenic
1022632402 7:32097706-32097728 CAGTGTTGGCTGAGGCTAGCTGG - Intronic
1023400826 7:39792335-39792357 CTGTGCAGGCTTCGGGAGGCAGG - Intergenic
1023780181 7:43647871-43647893 CTGGGCTGGCTGGGGGTGGCAGG - Intronic
1023991244 7:45130084-45130106 CTGGCCAGGCAGAGGGTGGCTGG - Intergenic
1026162099 7:67878541-67878563 CTTGGGAGGCTGAGGCTGGCGGG + Intergenic
1027176468 7:75906962-75906984 CTTTGGAGGCTGAGGCAGGCAGG + Intronic
1027184877 7:75965085-75965107 CTGTGTAGGATGGCGGTGTCTGG + Intronic
1028789299 7:94835188-94835210 CTGAGGAGGCTGAGGCAGGCAGG - Intergenic
1028998805 7:97130631-97130653 CTGTGATGGCAGAGGGTGGGAGG + Intronic
1029200712 7:98837384-98837406 CTGTGTGGGGAGAGGGTGGCTGG + Intergenic
1029565786 7:101336804-101336826 CTCGGGAGGCTGAGGGAGGCAGG - Intergenic
1029931747 7:104379159-104379181 CTGGTTAGGCTGAAGTTGGCAGG - Intronic
1030673910 7:112365241-112365263 CAGTGTTGGCTGAGGCTTGCAGG + Intergenic
1034072283 7:148198105-148198127 CTGAGAAGCCTGAGGGTGGCTGG + Intronic
1035589621 8:802597-802619 CTGTGGGTTCTGAGGGTGGCTGG - Intergenic
1035620386 8:1032263-1032285 CTGTGGAGGCAGTGGGCGGCCGG + Intergenic
1037716567 8:21406206-21406228 CCGTGCAGGCTGAGGGTCCCTGG - Intergenic
1037797934 8:22011706-22011728 CTCTGGAGGCTGAGGGGGGAGGG + Intergenic
1038115785 8:24553733-24553755 ATGTGCAGGCTGAAGGTGGAAGG - Intergenic
1040045508 8:42959474-42959496 TTCGGGAGGCTGAGGGTGGCGGG + Intronic
1040103117 8:43522300-43522322 CAGTGTTGGTTGAGGGTGGGGGG + Intergenic
1040890152 8:52308835-52308857 CTGTGTCGGCTCAGGGGGACTGG + Intronic
1041204559 8:55485612-55485634 TTTTGGAGGCTGAGGGGGGCAGG - Intronic
1042082599 8:65071522-65071544 CTGTGCAGCCTGGGGTTGGCTGG + Intergenic
1042281922 8:67064552-67064574 TGGTGTAGGTTGAGGGTGGAGGG + Intronic
1042947491 8:74169832-74169854 ATGTGTGGGCTGGGGGTGGGAGG + Intergenic
1043740242 8:83801890-83801912 CTGTGTAGCCTGGGGTTGGAGGG + Intergenic
1043997959 8:86842766-86842788 CTGTGCAGCCTGAGGTTGGAAGG - Intergenic
1046353506 8:113047093-113047115 CTGAGTGGTCTGAGGGAGGCTGG + Intronic
1047724099 8:127669488-127669510 CTGTGGAGGCTAAGGTTGGGTGG - Intergenic
1049006591 8:139859587-139859609 GTGTGTAGGCTGAGTGTCTCCGG - Intronic
1049212448 8:141392898-141392920 CTGTCTTGGCTGAGGGTGCCCGG - Intronic
1049312433 8:141940289-141940311 GTGTGTAGATTGAGCGTGGCTGG - Intergenic
1049376639 8:142292474-142292496 CTGTGGAGGTGGTGGGTGGCGGG + Intronic
1049616012 8:143576042-143576064 GTGGGTAGGCGGAGGGTGGCTGG - Intronic
1049713647 8:144078992-144079014 CTGTGTAGACTGAGGCGCGCCGG - Intronic
1049744689 8:144258305-144258327 CAGTGTCGGCTGAGGCTGGCTGG - Intronic
1049761354 8:144333176-144333198 CTGTGCAGGCCTAGGGCGGCGGG - Exonic
1052835785 9:33248918-33248940 TTTGGGAGGCTGAGGGTGGCAGG + Intronic
1055467650 9:76581769-76581791 CTGGGTACTCAGAGGGTGGCTGG - Intergenic
1055779139 9:79800354-79800376 CTGTGGAAGCTGATGGTGGTGGG + Intergenic
1056201225 9:84278648-84278670 CTGTACAGGGTGGGGGTGGCTGG + Intronic
1056479382 9:86985530-86985552 CAGTGGTGGCTGTGGGTGGCTGG - Intergenic
1056531561 9:87492765-87492787 CAGTGGAGGGTGAGGGTGGAGGG - Intergenic
1056670742 9:88625724-88625746 CTCGGGAGGCTGAGGTTGGCGGG - Intergenic
1056779168 9:89536772-89536794 GTGTGTAGGCTGAGGCTCACTGG + Intergenic
1056922990 9:90808589-90808611 CTGTGTGGTGTGTGGGTGGCAGG + Intronic
1060115866 9:120939935-120939957 ATGAGAAGGCTGTGGGTGGCAGG + Intergenic
1060988741 9:127836271-127836293 CTGGGTAGGCGCAGGCTGGCCGG - Intronic
1061416196 9:130448166-130448188 CTGCGGAGGCTGAGGGAGGGGGG + Intronic
1061545053 9:131299586-131299608 CCCTGTGGTCTGAGGGTGGCAGG + Intronic
1061547862 9:131315175-131315197 CAGGGTAGGCTGAGGGGGCCAGG + Intergenic
1061946509 9:133911335-133911357 GTGTGCAGGCTGTGTGTGGCTGG - Intronic
1062107992 9:134766158-134766180 CTGGGAAGGCTGAAGGGGGCAGG - Intronic
1062637384 9:137498681-137498703 CTGGGTGGGTGGAGGGTGGCTGG + Intronic
1185877472 X:3712805-3712827 CTGTGTGTGCTGGGGGTGGAGGG + Intronic
1185894024 X:3843052-3843074 CTGTGTGTGCTGGGGGTGGAGGG + Intronic
1185899142 X:3881476-3881498 CTGTGTGTGCTGGGGGTGGAGGG + Intergenic
1185904259 X:3919905-3919927 CTGTGTGTGCTGGGGGTGGAGGG + Intergenic
1185943065 X:4342640-4342662 CTTGGAAGGCTGAGGGTGGGAGG + Intergenic
1187487532 X:19718918-19718940 CTGTGTAGGCTGGTGGTGTCTGG - Intronic
1187733681 X:22282447-22282469 CTGTGTTGGATGAGTGGGGCTGG - Intergenic
1188196693 X:27243200-27243222 TTATCTAGGCTGAGGGTGGGTGG - Intergenic
1188303206 X:28530648-28530670 AGGTGTAGGGTGGGGGTGGCTGG - Intergenic
1189376663 X:40471962-40471984 CTGTGCAGGCTCAGGATGCCAGG - Intergenic
1190056706 X:47185419-47185441 CTGTAGAGGGTGAGGGTGGGCGG - Intronic
1192143004 X:68660954-68660976 CTGAGAAGGCTGGGGGAGGCTGG + Intronic
1192497334 X:71624663-71624685 CTGTGTAAGGTGAGAGGGGCTGG + Intergenic
1193204914 X:78736805-78736827 CTGTGCAGCCTGAGGTTGGGAGG + Intergenic
1198780489 X:140229908-140229930 CTCAGGAGGCTGAGGGTGGGAGG - Intergenic
1199435501 X:147808012-147808034 CTGGTTAGTCTGAGGGTGTCAGG - Intergenic
1199753144 X:150840091-150840113 CTCTGGAGGCTGAGGCTGGGGGG + Intronic
1200107419 X:153723013-153723035 CTGTCTGGGGTGGGGGTGGCAGG - Intronic
1200213688 X:154358129-154358151 GAGTGTGGGCTGCGGGTGGCTGG - Intronic
1201727986 Y:17174576-17174598 CTTGGAAGGCTGAGGGTGGGAGG + Intergenic