ID: 946311037

View in Genome Browser
Species Human (GRCh38)
Location 2:218882801-218882823
Sequence ACCCAGAATCAGCATGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 197}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946311025_946311037 25 Left 946311025 2:218882753-218882775 CCCTCTGCTTAGTAAACCACATT 0: 1
1: 0
2: 2
3: 11
4: 132
Right 946311037 2:218882801-218882823 ACCCAGAATCAGCATGAGGAGGG 0: 1
1: 0
2: 1
3: 18
4: 197
946311033_946311037 -10 Left 946311033 2:218882788-218882810 CCCATGAGGAAGAACCCAGAATC 0: 1
1: 0
2: 0
3: 21
4: 217
Right 946311037 2:218882801-218882823 ACCCAGAATCAGCATGAGGAGGG 0: 1
1: 0
2: 1
3: 18
4: 197
946311031_946311037 9 Left 946311031 2:218882769-218882791 CCACATTTAGGATGGGGAACCCA 0: 1
1: 0
2: 1
3: 13
4: 111
Right 946311037 2:218882801-218882823 ACCCAGAATCAGCATGAGGAGGG 0: 1
1: 0
2: 1
3: 18
4: 197
946311026_946311037 24 Left 946311026 2:218882754-218882776 CCTCTGCTTAGTAAACCACATTT 0: 1
1: 0
2: 2
3: 13
4: 195
Right 946311037 2:218882801-218882823 ACCCAGAATCAGCATGAGGAGGG 0: 1
1: 0
2: 1
3: 18
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946311037 Original CRISPR ACCCAGAATCAGCATGAGGA GGG Intronic
903500388 1:23797213-23797235 AAACAGAATAGGCATGAGGAGGG - Intronic
904253698 1:29241268-29241290 ACCCAGTACCAGCATGTGGGAGG + Intronic
905008101 1:34727360-34727382 ACCCAGAATCAAAATGAAAAAGG + Intronic
906809299 1:48809881-48809903 ACCCAGAATAAAACTGAGGAAGG - Intronic
908666007 1:66491986-66492008 GCCCAGAATCAATATGTGGAGGG - Intergenic
910201209 1:84701664-84701686 ACCCAGATTTAGAATGAGGTAGG + Intergenic
912271344 1:108212314-108212336 CCCCAAAATAAGCAGGAGGAAGG - Intergenic
912571058 1:110621468-110621490 ACCCAAAATGAGCAGAAGGAAGG + Intronic
913409324 1:118533553-118533575 GCCAAGAATTAGCTTGAGGAGGG - Intergenic
914225084 1:145713510-145713532 AGCCCAAGTCAGCATGAGGATGG + Intergenic
918445460 1:184612787-184612809 ACCCAGAGTCAACAAGAAGAAGG + Intronic
923721924 1:236474147-236474169 ACCCAGAATCAGGATGATTTGGG + Intronic
924875118 1:248094954-248094976 ACCCAGAATCAGACTAAAGAGGG - Intronic
1063181164 10:3601696-3601718 ACACAGAAATAGAATGAGGAAGG + Intergenic
1068426181 10:56867415-56867437 ACCCAGGAACAGCATCATGAAGG + Intergenic
1069878544 10:71577810-71577832 AGCCAGGATCAGCCTGGGGAGGG + Intronic
1069898129 10:71691580-71691602 TCCCAGAATCATCATGTGGAAGG - Intronic
1070337713 10:75469950-75469972 ACCCTGAATCAGCAATAGGAAGG + Intronic
1070724136 10:78776938-78776960 TCCCAGCATCAGAAAGAGGAAGG + Intergenic
1070887352 10:79915355-79915377 GGCCAGATTCAGCTTGAGGAGGG + Intergenic
1073053576 10:100685123-100685145 CCCCACAATCAGGATGAGAAAGG + Intergenic
1077770249 11:5210440-5210462 ATCCAGAATGAGCAAGTGGATGG + Intergenic
1078540784 11:12211446-12211468 AGTGAGAATCAGCATGAGGCTGG + Intronic
1082995264 11:59249225-59249247 ACCCAGAATCAGGATGAGAGAGG + Intergenic
1083002163 11:59302498-59302520 ACCCAGAATTAGGATGAGAGGGG + Intergenic
1083623307 11:64059485-64059507 ACCCAGGGTCAGCCTGTGGAAGG - Intronic
1084794350 11:71495050-71495072 ACCCAAAGCCAGCACGAGGAAGG - Intronic
1086555430 11:88104913-88104935 TCCCAGAAGCAGCATGAGAAGGG - Intergenic
1086800143 11:91163146-91163168 ACACAGAATCAACAGGAGGCAGG - Intergenic
1087344899 11:96959478-96959500 AGCCAAAATCAGAGTGAGGAAGG + Intergenic
1090165590 11:124543559-124543581 ACCCAGAAACAGGAAGAAGAGGG + Exonic
1096189588 12:49607160-49607182 ACCCAAAATAAGCAGAAGGAAGG + Intronic
1097613342 12:61853551-61853573 ACACAGAATTATCATAAGGATGG + Intronic
1101795413 12:107968506-107968528 AGCCAGTATCAGCAGCAGGATGG - Intergenic
1104530180 12:129562762-129562784 ACCCAGGAATAGCATGAGCAAGG - Intronic
1104726385 12:131078079-131078101 GCCCTGAAGCAGCAGGAGGAGGG - Intronic
1106781785 13:33066430-33066452 ACTCAGAGTCAGCATGAGGCGGG - Intergenic
1107063716 13:36189086-36189108 AGGAAGAATCAGCATGAGCATGG - Intronic
1107575537 13:41716625-41716647 ACCCACACTCAGGATGGGGATGG - Intronic
1110380163 13:74841199-74841221 AACTTGAATTAGCATGAGGAAGG - Intergenic
1110416442 13:75258775-75258797 ACCTAGAAGCACCAGGAGGAGGG - Intergenic
1110877934 13:80533860-80533882 ACCCAGAATTATGATGAGGTAGG + Intergenic
1117000365 14:51365427-51365449 TCCCTGAATCATCATGTGGAAGG + Intergenic
1119113429 14:71996518-71996540 ACCCTGACTCAGCCTGAGGTTGG + Intronic
1119282414 14:73420812-73420834 ACACAGAATCACCATGAATATGG + Intronic
1119768425 14:77205404-77205426 ACCTAGAATGAGCTTGAGGAGGG + Intronic
1119978336 14:79051117-79051139 AGCCAGAATCAGAATGTTGAAGG + Intronic
1120396196 14:83970213-83970235 ACCTAGAACCAGCAGGAGGGAGG - Intergenic
1120778629 14:88464990-88465012 AGCCAGAAACAGGAGGAGGAGGG - Intronic
1121262470 14:92576350-92576372 ACCCAGAGCCAGCATGTTGACGG - Intronic
1122019123 14:98821682-98821704 CCCCAGTTTCTGCATGAGGATGG - Intergenic
1122155301 14:99747011-99747033 ACCCAGGATAAGCATGACTAAGG + Intronic
1123509132 15:20978354-20978376 TCCCAGCATCAGTATGTGGAAGG - Intergenic
1123566354 15:21552101-21552123 TCCCAGCATCAGTATGTGGAAGG - Intergenic
1123602618 15:21989387-21989409 TCCCAGCATCAGTATGTGGAAGG - Intergenic
1124341584 15:28893372-28893394 AGCCAGAATCAGTAAGAGGCTGG - Intronic
1125115254 15:36083486-36083508 ACCCAAAATTAGTAAGAGGAAGG + Intergenic
1125269879 15:37926830-37926852 GCCCAAAATTAGCATAAGGAAGG + Intronic
1125605912 15:40939824-40939846 ACCCTGCAACAGCAGGAGGAAGG - Intergenic
1126991514 15:54382676-54382698 ACCCAAAATTAGCAGAAGGAAGG + Intronic
1127306846 15:57714442-57714464 ACCTAGAATCAGCAATAAGAGGG - Intronic
1129672635 15:77615811-77615833 GCCCAGCACCAGCAGGAGGATGG + Exonic
1202974723 15_KI270727v1_random:279189-279211 TCCCAGCATCAGTATGTGGAAGG - Intergenic
1202977485 15_KI270727v1_random:311459-311481 ACCCAAAGTCAGCAGAAGGAAGG - Intergenic
1133602087 16:7349593-7349615 CCTCAGAATCAAAATGAGGATGG + Intronic
1133735370 16:8610994-8611016 CCACAGAATCAGACTGAGGATGG + Intergenic
1135957782 16:26970688-26970710 TCCCAGAATCAATGTGAGGAGGG - Intergenic
1135980350 16:27142306-27142328 AGCCACATTCACCATGAGGACGG - Intergenic
1137667078 16:50257261-50257283 ACTCAGAAGCAGCAAGTGGAAGG + Intronic
1138516922 16:57541279-57541301 GCTCACATTCAGCATGAGGAAGG + Intergenic
1142700266 17:1655514-1655536 ACGCAGAATCAGGATGAGACGGG + Exonic
1143306402 17:5950786-5950808 AACCAGAATCAGCATCAGGGTGG - Intronic
1147788499 17:42997829-42997851 AACTAGAATAAGCATGAGGGAGG - Intergenic
1148063209 17:44850689-44850711 ACCCAGAAGCAGCATGGAGTGGG + Exonic
1150973363 17:70056100-70056122 AAACAGAATCAGACTGAGGAAGG + Intronic
1151792135 17:76313561-76313583 ACCTAGAATCCACATGATGAAGG + Intronic
1152563014 17:81087973-81087995 TCACAGAAACAGCTTGAGGACGG - Intronic
1153599106 18:6761611-6761633 ACCAAGGATCAGAATCAGGAAGG + Intronic
1153655505 18:7278424-7278446 ACCCAGAATCAACAGGAGCTGGG + Intergenic
1154338667 18:13485518-13485540 AGCCACAAGCAGCATGAGGATGG - Intronic
1154957757 18:21276065-21276087 AAACAGAATGAGAATGAGGAAGG - Intronic
1156645924 18:39162289-39162311 ACCAATAAACAGCCTGAGGAAGG + Intergenic
1157210804 18:45740385-45740407 ACGCTGAATCAGACTGAGGAGGG - Intronic
1158938028 18:62383105-62383127 ACCCCCAATTAGCATGAGGGAGG - Intronic
1159192552 18:65066166-65066188 ACCGAGAATTAGCAAAAGGAAGG + Intergenic
1160715740 19:575821-575843 ACCCATGAGCAGCAGGAGGAGGG - Intronic
1161479603 19:4503968-4503990 ACCCACTTTCAGCATGAGAACGG + Exonic
1164672291 19:30079051-30079073 AGCCAGAATCAGGGTGAGAAGGG - Intergenic
1164708204 19:30335860-30335882 ACCAAGAACCAGCAGGTGGATGG + Intronic
1165710343 19:38006274-38006296 ACCTAGAAGCAGCATGAGTGAGG + Intronic
1168209039 19:54875668-54875690 AAATAGAATCAGCATAAGGAAGG - Intronic
926367415 2:12145900-12145922 ACCCAGAACCAGCAGGAGAAAGG + Intergenic
930951254 2:57146425-57146447 ACCCAGGAGCTGCATGAGGTGGG + Intergenic
932157417 2:69430848-69430870 AGCCAGAATCAGCCAGAGTATGG + Intronic
932573452 2:72950360-72950382 AACCAGGATCAGCATGAGGTGGG - Intronic
933515688 2:83298043-83298065 ACCCAGGTTCCCCATGAGGATGG - Intergenic
933900020 2:86842908-86842930 GCCCAGGATCAGCTTGAGGCAGG - Intronic
934064220 2:88325052-88325074 AAGCAGAATCAACATGAGAAAGG + Intergenic
934869217 2:97845693-97845715 ACCCAGAGTAAGCAAAAGGAAGG + Intronic
935898891 2:107769283-107769305 ATCCAGCATCCTCATGAGGAAGG + Intergenic
939904218 2:147890869-147890891 TTGCAGAATCAGCTTGAGGAGGG + Intronic
942381859 2:175399888-175399910 ACCAAGAAACAGTGTGAGGAAGG - Intergenic
942648214 2:178137822-178137844 AGCAAAAATCAGCATGAGGCTGG + Intronic
943407154 2:187503675-187503697 CCTCAGAATCAGCATTAAGAGGG + Exonic
945322712 2:208444126-208444148 GCCCAGAATCAGAATCAGCAGGG - Intronic
946311037 2:218882801-218882823 ACCCAGAATCAGCATGAGGAGGG + Intronic
947811542 2:233007424-233007446 ACCCACGATCAGCCTGAGCAGGG - Intronic
1168835958 20:877621-877643 ACCAAGAACCAGGCTGAGGAAGG + Intronic
1170356702 20:15499830-15499852 GCCAAGAATCACCATGAGGTAGG + Exonic
1170863682 20:20133520-20133542 ACCCAGAATCAGAGTGAGAGGGG + Intronic
1171027035 20:21640273-21640295 ACATAGTATCAGCATAAGGATGG - Intergenic
1171196583 20:23204700-23204722 AGCCAGCATCAGAATGTGGACGG + Intergenic
1171365503 20:24620271-24620293 TTCAAGAAGCAGCATGAGGATGG + Intronic
1172699272 20:36843021-36843043 TCCCAGTGGCAGCATGAGGAGGG - Intronic
1173705854 20:45110001-45110023 AATCAGAATTAGCCTGAGGAGGG + Exonic
1174142104 20:48422563-48422585 ACCCAGTCTCACCATGAGAATGG - Intergenic
1174479471 20:50820631-50820653 ACCCAGCATCAGCCTGAAGAGGG + Intronic
1174519750 20:51120345-51120367 ACCCAGAACCAGCCTGATGGTGG + Intergenic
1175871583 20:62211821-62211843 CCCCAGAACCAGCACGAGGCAGG + Intergenic
1178252779 21:31020605-31020627 ACCCAGAAATGGCATGAGAAAGG + Intergenic
1179042704 21:37818004-37818026 ACCCAGAATGCACATGAAGATGG + Intronic
1179571420 21:42280927-42280949 ACCCAGAAACAGCTTCTGGAAGG - Intronic
1181625902 22:24121897-24121919 ACCCTGTAACAGGATGAGGAAGG - Intronic
1181663750 22:24374810-24374832 ACCCAAAATAAGCAGAAGGAAGG + Intronic
1181672275 22:24431268-24431290 ACACAGAAGCAGGAGGAGGAAGG - Intronic
1183270242 22:36857578-36857600 CCCCAGCACCTGCATGAGGAAGG + Intergenic
949581887 3:5396847-5396869 TCCCAGACTCAGGATGAAGATGG + Intergenic
950895820 3:16449934-16449956 ACCAGGAAGCAGCAGGAGGAGGG + Intronic
950939148 3:16875980-16876002 ACCCAGAATCAGCAGGTCAAAGG + Intronic
951643918 3:24866558-24866580 AACCAGAATCAGCAAGAGAAGGG + Intergenic
955544845 3:60017417-60017439 ACCCAAAGTCAGGATGAGAAGGG - Intronic
957155241 3:76536981-76537003 AGCCAGACTGAGCGTGAGGAAGG + Intronic
958623580 3:96595487-96595509 TCCCAGGATCAGGATCAGGAAGG - Intergenic
965241907 3:166211880-166211902 ACCCAGATTCAGCATCATGCAGG - Intergenic
966998048 3:185303846-185303868 ACCCAGTATTAGTATTAGGAAGG - Intronic
967154572 3:186680878-186680900 ACCCTGAATCACCATTTGGATGG - Intergenic
967892974 3:194376107-194376129 ACGCATCATCACCATGAGGAAGG - Intergenic
968611870 4:1560904-1560926 GCCGAGAGGCAGCATGAGGAGGG + Intergenic
970097882 4:12486141-12486163 ACCCAGAGTCAGCATGACCAAGG + Intergenic
972049061 4:34705260-34705282 ACCCAAAGTCAACAGGAGGAAGG + Intergenic
972624793 4:40786170-40786192 ACCCAGAATAACAATGTGGAAGG - Intronic
973128750 4:46622517-46622539 GCCCAGAGTCAGCAGAAGGAAGG - Intergenic
975854262 4:78606400-78606422 ACCCAGGATCAGGATGTGCATGG - Intronic
975967171 4:79987155-79987177 ACACAGAATCAGAATCTGGATGG + Intronic
976184178 4:82429248-82429270 AGCAAGAATCAGCAGGATGACGG - Exonic
978167457 4:105625879-105625901 AAGAAGGATCAGCATGAGGAAGG - Intronic
978496244 4:109362237-109362259 AACCACAAGCAGCATGCGGATGG + Intergenic
978868543 4:113545795-113545817 TCCCAGAATCAGAATAAGAATGG + Intronic
980830236 4:138122257-138122279 ACTCAAAATTAGCATGAGGAAGG - Intergenic
982729957 4:158945262-158945284 ACCCAGAACACGGATGAGGAGGG - Intronic
983589201 4:169389254-169389276 GCACAGAAACAGCATGAGGTAGG - Intergenic
984777002 4:183490572-183490594 ACCATCAATCAGAATGAGGAAGG - Intergenic
985722637 5:1497770-1497792 ACCTAGAGTCATCATGGGGATGG + Intronic
985762671 5:1758825-1758847 ACCCAGTGTCACAATGAGGAGGG - Intergenic
986179658 5:5382045-5382067 TCCCAGAATCTGTGTGAGGAGGG - Intergenic
986259740 5:6133973-6133995 ACCCAGAACCACCATGGGGAAGG + Intergenic
987748116 5:22004245-22004267 ACAGAAAAACAGCATGAGGAAGG - Intronic
988633464 5:32956110-32956132 TCCCAGAATCAACAATAGGATGG - Intergenic
990712570 5:58601879-58601901 ACACAAAAGCAGCATAAGGAAGG - Intronic
993039219 5:82793418-82793440 ACCTAGAGTTATCATGAGGAGGG + Intergenic
993208064 5:84910454-84910476 ATCCTGAATGATCATGAGGAAGG + Intergenic
994854566 5:105100143-105100165 ACACAAAATCAACATGGGGATGG + Intergenic
998200981 5:140120640-140120662 AGCCAGAATTAGCATGAGTCAGG + Exonic
999137293 5:149330632-149330654 AACCAGAATCAATAGGAGGAAGG + Intronic
1002200605 5:177525650-177525672 ACCCAGACATAGCATCAGGAAGG - Intronic
1002755815 6:158542-158564 TTCCATAGTCAGCATGAGGATGG - Intergenic
1002924541 6:1597370-1597392 ACTGAGAATTAACATGAGGATGG - Intergenic
1002945719 6:1759188-1759210 ACCCATAAATAGCATGGGGAAGG + Intronic
1004394569 6:15236573-15236595 ACCCAGAATCCGAAAGATGAGGG + Intergenic
1006677648 6:35775964-35775986 ACAGAGAATCAACATCAGGAAGG + Intergenic
1007154811 6:39732226-39732248 ACCCAGATTCAGGATGAATAAGG - Intergenic
1008597298 6:53055199-53055221 ACTCAGAATTACCATGAGAAGGG - Intronic
1011466355 6:87661425-87661447 ACCTAGAATTAGAATGAGCAAGG + Intronic
1011492852 6:87910492-87910514 ACACAGAATCAGCAGGAGGATGG + Intergenic
1014980785 6:127943779-127943801 CCCCACAGTCAGCATGAGGTGGG + Intergenic
1017111265 6:150935025-150935047 ACCCAGAATAACAATGTGGAAGG - Intronic
1017590501 6:155974074-155974096 ACACAAAATCAGGAAGAGGAAGG + Intergenic
1020495854 7:8852586-8852608 ACCCAGAACCAACATGAGATTGG - Intergenic
1020919855 7:14249855-14249877 ACCCAAAATTAGCAGAAGGAGGG - Intronic
1021112530 7:16711918-16711940 ACACTGAATCAGCATGAGCTGGG - Intergenic
1021557459 7:21935496-21935518 ACCCAAAGTTAGCAAGAGGAAGG + Intronic
1023217934 7:37885412-37885434 ACCCAGTGACAGCCTGAGGATGG + Intronic
1023294057 7:38696948-38696970 ACCCAGCATCAGGGAGAGGAAGG + Intergenic
1024490058 7:49971257-49971279 ACACAGAATCACCATAATGAGGG + Intronic
1024609014 7:51046815-51046837 ACCCAGGGGCAGCAGGAGGAGGG + Intronic
1033168693 7:139064563-139064585 ACCCAGAATCAGAAACAGCATGG + Intronic
1033203178 7:139392615-139392637 ACCAAGAATAAGCTTGTGGAAGG + Intronic
1037478671 8:19283330-19283352 ACCCAAAAGTAGCAGGAGGAAGG - Intergenic
1037959967 8:23090002-23090024 ACCCAGAATAAGCATAAGAAAGG + Intronic
1037978192 8:23229106-23229128 ACCCAGAATAAGTATAAGAAAGG - Intergenic
1040552173 8:48445977-48445999 AAACAGAATGAGCATGAGGCTGG - Intergenic
1041264610 8:56052169-56052191 ACACAGAATGAGCCTGGGGATGG + Intergenic
1045128924 8:99126247-99126269 ACTCAGAGTAAGCATGGGGAAGG + Intronic
1047172162 8:122504188-122504210 ACCCAAAACCAGGTTGAGGAAGG + Intergenic
1048268032 8:133004812-133004834 TCCCAGCACCAGCATGAGAATGG + Intronic
1048383741 8:133892100-133892122 AAACAAAATCAGCAAGAGGATGG - Intergenic
1048852393 8:138657596-138657618 ACACAGGACCAGCATGTGGATGG + Intronic
1051317729 9:15860290-15860312 ACCCAAAATTAGCAGAAGGAAGG - Intronic
1052688737 9:31787614-31787636 ACACAGAGTCATCATGAAGATGG + Intergenic
1052842356 9:33303473-33303495 GCCCAGAAGCAGCATGAGCCTGG - Intronic
1053116521 9:35509051-35509073 AATCAGAATCAGAATGAGGCTGG + Intronic
1056683729 9:88742483-88742505 ACCCATAATCAGCCTGAGCAAGG - Intergenic
1056792263 9:89633526-89633548 GCCCAGGATAACCATGAGGATGG + Intergenic
1057171161 9:92964021-92964043 ACCCAGCAGAAGCAGGAGGATGG + Intronic
1059715202 9:116906768-116906790 GCCCAGAATCAGAATATGGAGGG + Intronic
1062652447 9:137585039-137585061 ACTCACAAGCAGTATGAGGAAGG + Intronic
1062712221 9:137982238-137982260 AGCCATAATGAGCATGAGGCTGG - Intronic
1186864835 X:13709393-13709415 ACACAAAATCAACATGGGGATGG + Exonic
1187856345 X:23639271-23639293 ACCCAAAGTCAGCAGAAGGAAGG + Intergenic
1189744880 X:44158890-44158912 ACCCAGAATCCCCTTGAGGAGGG + Intronic
1192225679 X:69226434-69226456 GCCCAGAATCCCCAGGAGGAGGG - Intergenic
1192840742 X:74852912-74852934 ACCCAAAATTAGTAGGAGGAAGG + Intronic
1195615067 X:106905671-106905693 TCCGAGAATCAGCAGAAGGAAGG + Intronic
1197110772 X:122771595-122771617 ACTCACACTCAACATGAGGAGGG - Intergenic
1197493263 X:127145675-127145697 ACCCAGAATGACCCTGAGGTAGG - Intergenic
1197876684 X:131115859-131115881 ACCCAAAGTTAGCAAGAGGAGGG - Intergenic
1200225249 X:154413402-154413424 CCCCAGCATCAGCATGCAGAAGG - Intronic