ID: 946311493

View in Genome Browser
Species Human (GRCh38)
Location 2:218884551-218884573
Sequence TCTGAGAAGTAGAAGGTAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 563
Summary {0: 1, 1: 0, 2: 1, 3: 38, 4: 523}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946311493_946311498 27 Left 946311493 2:218884551-218884573 CCTTCTACCTTCTACTTCTCAGA 0: 1
1: 0
2: 1
3: 38
4: 523
Right 946311498 2:218884601-218884623 CTGCCAATCCTCTCCTCCACTGG 0: 1
1: 1
2: 1
3: 23
4: 225
946311493_946311497 -4 Left 946311493 2:218884551-218884573 CCTTCTACCTTCTACTTCTCAGA 0: 1
1: 0
2: 1
3: 38
4: 523
Right 946311497 2:218884570-218884592 CAGAAGGGACTCTGTGCTTCTGG 0: 1
1: 1
2: 2
3: 26
4: 251

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946311493 Original CRISPR TCTGAGAAGTAGAAGGTAGA AGG (reversed) Intronic
900946752 1:5835099-5835121 TGAGGGAAGGAGAAGGTAGAGGG + Intergenic
903049600 1:20590816-20590838 TTGGAGAAGCAGAAGGAAGAGGG + Intronic
904310837 1:29628574-29628596 TCAGAGAAGTAAATGGAAGATGG + Intergenic
904541364 1:31235858-31235880 TGTGGGAAGTAGCAGGTAGTTGG - Intronic
904937147 1:34139398-34139420 GCTGAGAAGTCCAAGGTCGAGGG - Intronic
905761776 1:40564475-40564497 TGTGAGAAAGAGAAGATAGAGGG - Intergenic
906192622 1:43907705-43907727 CCTGAGAAGGTGAAGGGAGATGG - Intronic
907438924 1:54466428-54466450 TCTGAGAATTGAAAGGTAGCGGG + Intergenic
908636875 1:66176476-66176498 TGTGATAATTAGAAGGTTGAAGG + Intronic
908722462 1:67140076-67140098 ACTGAGAAGTGCAAGGTTGAGGG - Intronic
908731250 1:67228822-67228844 TCTTATAAGCAGAAGGGAGAAGG - Intronic
910161257 1:84275043-84275065 GCTGAGAAGTCCAAGGTTGAGGG - Intergenic
910469907 1:87540588-87540610 TTTGAGAAGTCCAAGGTTGAGGG - Intergenic
910732693 1:90415358-90415380 CCTGAGAAGTGGAAGAGAGATGG - Intergenic
911239989 1:95454676-95454698 TCTGAGAAGTTACAGGTAAATGG - Intergenic
911761609 1:101623497-101623519 TCTGGGAAGTCCAAGGTTGAGGG - Intergenic
911786463 1:101955528-101955550 TTTAAGAAGTAGAAGATGGATGG - Intronic
912180393 1:107212113-107212135 TATGAGAACTAGAAGGTGTAGGG + Intronic
912278972 1:108292998-108293020 GCTGAGAAGTCCAAGGTTGAGGG - Intergenic
912289254 1:108401359-108401381 GCTGAGAAGTCCAAGGTTGAGGG + Intronic
913228876 1:116724500-116724522 CCTGGGAAGTACAAGGTACAGGG + Intergenic
915567375 1:156723099-156723121 TTTAAGAAGTAAAAGGTATAGGG + Exonic
915985614 1:160461292-160461314 TCTGAGAAGTAGAAGGCTATTGG + Intergenic
916051863 1:161042060-161042082 TCTGAGAAGTAAGATGAAGAAGG - Intronic
918311430 1:183288188-183288210 TCTGAGAAGTAGAAAATGGCTGG + Intronic
919211451 1:194492477-194492499 GCTGAGAAGTCCAAGGTTGAGGG + Intergenic
919559814 1:199102510-199102532 TCATAGAAGCAGAAAGTAGAAGG - Intergenic
920287464 1:204890883-204890905 TCTAAGAAGTGGGTGGTAGAGGG + Intronic
921081511 1:211742367-211742389 TCACAGAAGTAGAAGGTACCAGG - Intergenic
921404890 1:214767844-214767866 TATGACAAGTAGAAGATAGTAGG + Intergenic
922447415 1:225709134-225709156 CCTGTGAAGTAGGAGGTAGGGGG + Intergenic
923135066 1:231110216-231110238 TCTGAAAGGTAGAAAGAAGAAGG + Intergenic
923445462 1:234066607-234066629 TTTGGGAAGGAGAAGGTAGTGGG - Intronic
924177845 1:241410999-241411021 TGTGAGGTTTAGAAGGTAGAGGG - Intergenic
924498570 1:244614080-244614102 GCTGAGAAGTCCAAGGTCGAAGG - Intronic
924736769 1:246764224-246764246 TCTGTGAAGGAGAAGGCAAAGGG - Exonic
924783736 1:247175296-247175318 TCTGTGAATTTGAAGGTGGAGGG + Intergenic
1063287774 10:4709126-4709148 TGTAAGCAGTAGAATGTAGAGGG + Intergenic
1063441069 10:6073642-6073664 TCACAGAAGTAGAAAGTAGAAGG - Intergenic
1063645945 10:7883851-7883873 GTTGGGAAGTACAAGGTAGAGGG + Intronic
1063783901 10:9358098-9358120 TCATAGAAGTAGAAGAGAGATGG - Intergenic
1064756970 10:18580298-18580320 TCGGAGAAGTGGAAAGTAGTTGG - Intronic
1064924442 10:20554739-20554761 TCTGAGAAGGAGAAGGATGAAGG - Intergenic
1064963760 10:20994865-20994887 GCTGAGGAGGAGGAGGTAGAGGG + Intronic
1065229241 10:23580027-23580049 TTTGAGATTTAGAAGGCAGAAGG - Intergenic
1066010979 10:31193164-31193186 GCTGAGAAGTCCAAGGTCGAGGG + Intergenic
1066200564 10:33139799-33139821 TCTGAGAAGTCCAAGATTGATGG + Intergenic
1068275599 10:54792004-54792026 CCTGAGAAGTAGAAAGAACAAGG + Intronic
1068624526 10:59227214-59227236 GCTGAGAAGTCCAAGGTGGAGGG + Intronic
1068632314 10:59310780-59310802 TCAGAGAAGTACAAGGTGGGAGG - Intronic
1070460406 10:76662331-76662353 GCTAAGAAGTAAAAGGTATAAGG + Intergenic
1071957825 10:90778487-90778509 GCTGAGAAGTCCAAGGTTGAGGG - Intronic
1072457260 10:95587786-95587808 TCTGAAAGGTAGGAGGAAGAGGG + Intergenic
1075398784 10:122146649-122146671 TCTGAGAAGTCAAAGGTCAAGGG - Intronic
1075907684 10:126095779-126095801 GCTGAGAAGTTCAAGGTAGGGGG - Intronic
1078124210 11:8543557-8543579 TCATAGATGTAGAAAGTAGAAGG + Intronic
1078831617 11:14982814-14982836 GTTGAGAAGTACAAGGTTGAGGG + Intronic
1078879937 11:15438061-15438083 TCTGAGAAGAAGTGGGGAGAGGG + Intergenic
1079570892 11:21942259-21942281 TCTGAAAAGTAAAAAGAAGAAGG - Intergenic
1081824769 11:46038612-46038634 GCTGAGAAGTCCAAGGTGGAGGG + Intronic
1082612680 11:55320801-55320823 TCCCAGCAGTAGAAAGTAGATGG + Intergenic
1083201209 11:61122161-61122183 TTGCAAAAGTAGAAGGTAGAAGG - Intronic
1085502887 11:77039174-77039196 GCTGAGAAGGACAAGGAAGAAGG + Intronic
1085503839 11:77044439-77044461 TCTGAGAGGTTGAAGGAAGCAGG + Intergenic
1086564294 11:88207600-88207622 TCACACAAGTAGAAGGTTGAAGG - Intergenic
1086935760 11:92743956-92743978 GCTGAGAAGTCCAAGGTTGAGGG - Intronic
1087446140 11:98256049-98256071 TCTTAGAAGTAGAATTTAAAAGG - Intergenic
1087658782 11:100960744-100960766 TCTGAGAAATAGAAGTCTGATGG + Intronic
1088091233 11:106042204-106042226 TTTGAGAAGAAAAAGGTGGAAGG - Intergenic
1088177410 11:107069337-107069359 GCTGAGAAGTCCAAGGTTGAGGG - Intergenic
1088277358 11:108101884-108101906 TCAGAGAGGAAGAAGGAAGAAGG - Intronic
1088753577 11:112866323-112866345 TAGGAGAAGTGGAAGGAAGAGGG - Intergenic
1088900446 11:114112403-114112425 TGAGAGATGGAGAAGGTAGAGGG + Intronic
1090239064 11:125169329-125169351 ACTGAGAAGCAGAATTTAGAGGG + Intronic
1090432067 11:126654436-126654458 TCTGAAATGTTGAAGGTGGAGGG + Intronic
1090943449 11:131409235-131409257 TTTGAGAAGCAGAAGGAAGCAGG + Intronic
1092009379 12:5096911-5096933 TTTGAGAGCTAGAAAGTAGAAGG - Intergenic
1092264915 12:6973496-6973518 TCTCAGAAGTAAAAGGAAGAGGG - Intronic
1094719695 12:33051793-33051815 GCTGAGAAGTTCAAGGTTGAGGG - Intergenic
1094744164 12:33324581-33324603 GCTGAGAAGTTCAAGGTCGAGGG + Intergenic
1095162068 12:38930416-38930438 TCCCAGAAGTAGAAGGAACATGG + Intergenic
1095326111 12:40895403-40895425 GCTGAGAAGTCCAAGGTTGAGGG + Intronic
1095748602 12:45686887-45686909 GCTGAGAAGTCCAAGGTGGAGGG + Intergenic
1096174174 12:49501258-49501280 TCTGAGAAGTTTAAGGTCAAGGG + Intronic
1096582020 12:52591852-52591874 TCTGAGGATGAGAATGTAGAAGG - Intronic
1096949701 12:55454668-55454690 TTTGATAAGGAGAAAGTAGATGG + Intergenic
1097381952 12:58905837-58905859 GCTGAGAAGTCCAAGGTTGATGG - Intronic
1097787588 12:63778873-63778895 TCTCAGAAGGAGAAGGTTGGGGG + Intergenic
1098237898 12:68435622-68435644 TGTGAGAAGAAGAAGTAAGAGGG + Intergenic
1098271606 12:68775372-68775394 ACTGAGAAGTCCAAGGTACAGGG + Exonic
1098754579 12:74343707-74343729 TCTCAGAAGAAGCAGATAGAAGG - Intergenic
1099055589 12:77835865-77835887 TCTGGGATGTAGCAGCTAGATGG - Intronic
1099726305 12:86432320-86432342 TCTGTGAAGTAGCAGATACATGG + Intronic
1099804920 12:87506904-87506926 GCTGAGAAGTCTAAGGTTGAGGG + Intergenic
1100258387 12:92907382-92907404 TCTGAGATGGAGAATGTAGATGG - Intronic
1100357391 12:93844213-93844235 TTTGAGAAGTAGTAGCCAGATGG + Intronic
1100386091 12:94105610-94105632 GCTGAGAAGTCCAAGGTCGAGGG + Intergenic
1100683019 12:96949604-96949626 TCAGAGAAGAATAAGGTTGAAGG + Intronic
1101077077 12:101141590-101141612 TCTGAGAAGTAGACAGAGGATGG + Intergenic
1101755022 12:107614586-107614608 TCTGCTAGGTAGAAGGAAGAAGG + Intronic
1101916718 12:108901698-108901720 TCTGAGAAGTCCAAGGTTGAGGG + Intergenic
1102877957 12:116462352-116462374 GCTGAGAAGTCCAAGGTCGAGGG + Intergenic
1102904929 12:116667187-116667209 ACTGACAAGCTGAAGGTAGAAGG + Intergenic
1103205778 12:119127764-119127786 AGGGAGAAGGAGAAGGTAGAAGG + Intronic
1103860998 12:124013805-124013827 TATGAGAAGTGGATGGTAGGAGG + Exonic
1104693684 12:130847234-130847256 TCTTAGAAGTAGGAGCTAAATGG - Intergenic
1104876497 12:132038646-132038668 TGTGGGTAGTAGAAGATAGAGGG + Intronic
1105601853 13:21894620-21894642 TCTGAGAAGTTGAAACTTGAAGG + Intergenic
1106550151 13:30764078-30764100 AATGAGAAGTAGAGGGGAGATGG - Exonic
1107437346 13:40391735-40391757 TCTGAGGTGGAGAAAGTAGAGGG - Intergenic
1107790464 13:43997089-43997111 TCTGAGAACTAGCAGCTATAAGG + Intergenic
1108598891 13:51973613-51973635 ACTGAGAAGTCTAAGGTTGAGGG - Intronic
1109156228 13:58913465-58913487 TCTGAAAGGTAGAAAGAAGAAGG + Intergenic
1109379399 13:61540131-61540153 TCTGTGAAGTAGAATATACAAGG - Intergenic
1109489570 13:63078206-63078228 TCATTGAAGTAGAAAGTAGATGG - Intergenic
1109720771 13:66273420-66273442 GCTGAGAAGTCCAAGGTTGAGGG - Intergenic
1110023396 13:70505567-70505589 TTAGAGAGGTAGCAGGTAGAAGG + Intergenic
1110350444 13:74501164-74501186 TCTGAAAAGTAGATGGTAGCAGG - Intergenic
1110600485 13:77366860-77366882 TCTTAGAAGTCCATGGTAGATGG - Intergenic
1111233964 13:85383741-85383763 TCACAGAGGGAGAAGGTAGAGGG - Intergenic
1111283986 13:86064263-86064285 TCTGGGAAGTCCAAGGTAAAGGG - Intergenic
1112606809 13:100914414-100914436 TCTGACAAGGAGTAGGCAGATGG + Intergenic
1112748676 13:102556642-102556664 TCCGTGAAGTAGCAGGCAGAAGG + Intergenic
1113285217 13:108839055-108839077 GCTGAGAAGTCCAAGGTTGAGGG + Intronic
1116286413 14:42978248-42978270 TCATAGAAGTAGAGAGTAGAAGG - Intergenic
1116753922 14:48922037-48922059 TAATAGAAGTAGAAGGGAGAAGG - Intergenic
1118150568 14:63184883-63184905 TCTTAGAAGTATAATGTTGAGGG - Intergenic
1118805297 14:69231246-69231268 TCTGAGGAGAAGAAGGAAGAAGG - Intronic
1119462946 14:74825957-74825979 TCTGAGAAGCAAATGGTAGACGG - Intronic
1119658225 14:76432501-76432523 TCTGTGAAGTAGGAGGGACAGGG - Intronic
1119684902 14:76623727-76623749 GCTCAGAAGAAGCAGGTAGATGG - Intergenic
1119739961 14:77007929-77007951 TCTGGGAAGGAGAGGGTAGGAGG - Intergenic
1120140164 14:80921447-80921469 GCTGAGAAGTCCAAGGTTGAGGG - Intronic
1121753105 14:96375759-96375781 GCTGAGAAGTCCAAGGTAGAGGG + Intronic
1122530458 14:102421916-102421938 TCTGAGAAGTATTTGGGAGAAGG + Intronic
1124104566 15:26725348-26725370 TCTGAGGAGGGGAAGGTGGAGGG - Intronic
1125302008 15:38264881-38264903 TCTGAGAATTAGCAAGTAGAGGG + Intronic
1125445881 15:39755604-39755626 TCTGATATGCAGAGGGTAGAGGG - Intronic
1125731220 15:41893734-41893756 TCTGAGAAGAAGAATCTGGAAGG - Intronic
1126450841 15:48807127-48807149 TCTGAGAAGCAGAGGCTGGAGGG - Intronic
1126989408 15:54355124-54355146 GCTGAGAAGTCCAAGGTTGAGGG - Intronic
1127324939 15:57885803-57885825 TCTCAGCAATAGAAGGCAGAAGG - Intergenic
1127575123 15:60284470-60284492 TCTGAGGAGCATAAGGTAGAAGG + Intergenic
1128678187 15:69627189-69627211 TCTGAGCAGTAGAAAGGAGGTGG - Intergenic
1129095511 15:73202811-73202833 TCATAGAAATAGAAGGTAAAAGG - Intronic
1129148452 15:73671009-73671031 CCTGAGAAACAAAAGGTAGATGG - Intergenic
1130557563 15:84933515-84933537 GCTGAGAAGTCCAAGGTCGAGGG + Intronic
1130828665 15:87577015-87577037 GCTGAGAAGTCCAAGGTCGAAGG - Intergenic
1131867807 15:96730710-96730732 CCAGAGAAGCAGAGGGTAGAGGG + Intergenic
1132002969 15:98198417-98198439 TCTGTTAAGTAGAAGAGAGAGGG - Intergenic
1132024764 15:98395619-98395641 GCTGAGAAGTCCAAGGTGGAGGG - Intergenic
1133469258 16:6058341-6058363 TCTGAGAAGGAGAGGGAGGAAGG - Intronic
1133865519 16:9638365-9638387 TCTGGGAAGCAGAAGGTAGCAGG - Intergenic
1134086901 16:11363468-11363490 TGTGAGAAGTTGAAGGGAGGGGG + Intronic
1134229796 16:12419895-12419917 TCTGACTAGCAGAAGGGAGATGG + Intronic
1135045737 16:19153678-19153700 TCTGAGAAGTGGAAGGGAACTGG + Intronic
1135192886 16:20369111-20369133 TTTGAGGAGGAGAAGGGAGATGG - Intronic
1135494780 16:22941836-22941858 GCTGAGAAGTCCAAGGTTGAGGG - Intergenic
1135606378 16:23828656-23828678 GCTGAGAAGTCTAAGGTTGAGGG + Intergenic
1136926448 16:34379737-34379759 TTTGATAAGTAGAAGGAGGAGGG - Intergenic
1136978126 16:35032070-35032092 TTTGATAAGTAGAAGGAGGAGGG + Intergenic
1137253141 16:46754612-46754634 GCTGAGAAGTCCAAGGTTGAGGG - Intronic
1137424401 16:48365590-48365612 TCTGAGAAGTAAATGGTATTTGG - Exonic
1138320284 16:56105745-56105767 TCTGAGATGTACTAGGCAGAAGG + Intergenic
1139436642 16:66940415-66940437 GCTGAGAAGTAGCAGGGACAGGG - Exonic
1139829042 16:69781766-69781788 TCTGGGAAGTCTAAGGTGGAGGG + Intronic
1141058261 16:80839154-80839176 TCATAGAAGTAGAGAGTAGAAGG - Intergenic
1141171622 16:81695263-81695285 TTTAGGAAGGAGAAGGTAGAAGG - Intronic
1141983868 16:87566871-87566893 TCTGAGAAGTTCAAGGTTGGGGG - Intergenic
1142309849 16:89306075-89306097 TCTGCGGAGTGGGAGGTAGATGG - Intronic
1144319059 17:14095998-14096020 TCTGAGAAGTCCAAGGTCCAGGG + Intronic
1147462375 17:40581549-40581571 TCTGAGAATGAGCAGGGAGAAGG + Intergenic
1147490297 17:40859769-40859791 TCAAAGAAGCAGAAGGGAGAGGG - Intergenic
1148792804 17:50183187-50183209 TCTGGGAAGGAGCAGGCAGAAGG + Intergenic
1148831145 17:50432421-50432443 TCTGGGGAGTAGGAGGGAGAAGG + Intronic
1149028781 17:52061225-52061247 TCTGAAAAGTGGGAGGCAGAAGG + Intronic
1149644081 17:58226989-58227011 GCTGAGAAGTCTAAGGTTGAGGG - Intronic
1150010915 17:61502698-61502720 TCTGAGATGTAGTAGGAAAACGG + Intergenic
1150206840 17:63415441-63415463 GCTGAGAAGAAGAAGGGAGTGGG + Intronic
1151271374 17:72998847-72998869 TCTGAGAGGTGGAAGGGAGATGG + Intronic
1153289354 18:3485174-3485196 TCTGAGAATTAGAATGCAGCAGG - Intergenic
1154138609 18:11802836-11802858 TCTGAGCAGAAGCTGGTAGAAGG + Intronic
1155274918 18:24177451-24177473 TCTGAAAAGTAGATAGTAGCAGG - Intronic
1155345094 18:24849890-24849912 TCTATAAAGTAGAAGGTAGTGGG - Intergenic
1155532089 18:26777528-26777550 TCTGAGAAAAAGAAGGTGGGAGG - Intergenic
1155552450 18:26979605-26979627 TCTTAGAAGAAGAAGAGAGATGG - Intronic
1156036505 18:32771741-32771763 TATGAGAAGTTCAAGTTAGAAGG + Intronic
1156083868 18:33375883-33375905 ACTGAGAAGCATAAGGCAGAAGG + Intronic
1156558900 18:38099172-38099194 TTTGAGAAGTAGAATGTTGGAGG - Intergenic
1156919782 18:42507506-42507528 TCCTGGAAGTAGAAGGTAGATGG + Intergenic
1157688997 18:49665465-49665487 TCTGAGAAGTCCAAGGAGGAGGG - Intergenic
1158304773 18:56093123-56093145 AGTGAGAATTGGAAGGTAGAAGG - Intergenic
1159397055 18:67873074-67873096 TTTGAAAAGTATAAGCTAGAAGG - Intergenic
1160190793 18:76712618-76712640 TCTGAGAAGGAGCAGGGAGCGGG - Intergenic
1160191346 18:76716761-76716783 TCTGAGAAGGAGCAGGGAGCTGG - Intergenic
1160226515 18:77016279-77016301 TCTGAGAAGTGGAAGGGGGGAGG - Exonic
1164896716 19:31883264-31883286 ACGGAGAAGTAGAAGAGAGAAGG + Intergenic
1165553587 19:36609358-36609380 TCTAAGAAGGAAAAGGTATATGG - Intronic
1165561010 19:36679781-36679803 TCTTAGAAGTAGAGAGTAGGAGG + Intergenic
1167571519 19:50292021-50292043 GCTGAGAACTAGAAGGCAGCTGG - Intronic
1168387578 19:55978431-55978453 GCTGAGAAGTCCAAGGTGGAGGG + Intronic
925097624 2:1219894-1219916 TTTCAGAAGAAGAAGGCAGATGG + Intronic
925251591 2:2443597-2443619 ACTGAGAAGTCAAAGGTTGAGGG + Intergenic
925488348 2:4362544-4362566 TCTTAGAAGCAGAGAGTAGATGG - Intergenic
925869909 2:8261158-8261180 TCTGAAAATTAGGAGGCAGAGGG + Intergenic
926042946 2:9689626-9689648 CCTGAGAAGGGGAAGGTAGGGGG + Intergenic
926377077 2:12241554-12241576 TCTGAGGAGGAGGAGGAAGAGGG + Intergenic
926388167 2:12359352-12359374 TCAGAGCAGTAAAAGGCAGAAGG + Intergenic
926551996 2:14312135-14312157 GCTCTGAATTAGAAGGTAGAGGG + Intergenic
926587127 2:14699127-14699149 GCTGGGAAGTACAAGGTTGAGGG - Intergenic
926942116 2:18149585-18149607 GCTGAGAAGTCCAAGGTTGAAGG + Intronic
926945028 2:18178149-18178171 TCAGAGAGATAGAAAGTAGAAGG - Intronic
927123058 2:19986682-19986704 CCTGAGAAGGTGAAGGGAGATGG + Intronic
927446107 2:23162787-23162809 GCTGAGAAGTCCAAGGTCGAGGG - Intergenic
927459983 2:23290213-23290235 ACTGAGAAGTGGAAGAGAGATGG - Intergenic
927746379 2:25625688-25625710 ACTCAGAAGCAGAAGGTACAAGG - Intronic
927828521 2:26327596-26327618 GCTGAGAAGTCCAAGGTTGAGGG + Intronic
928615828 2:33038680-33038702 TCTGAGAAGTAGAAAATATTTGG + Intronic
928708459 2:33977623-33977645 TCTGAGAATTATAACTTAGATGG + Intergenic
928930644 2:36620333-36620355 GCTGGGAAGTACAAGGTGGAGGG - Intronic
929098227 2:38284337-38284359 TAGGAGAAAGAGAAGGTAGAAGG + Intergenic
929728258 2:44456429-44456451 TCTGAGAAATAGAGGGTAAGAGG - Intronic
930194159 2:48492618-48492640 TATGAGAAGTAGAATGTTGTAGG + Intronic
930256715 2:49101795-49101817 TCTGAGAAGTCCAAGGTCAAGGG + Intronic
930749738 2:54922850-54922872 TCACAGAAGTAGAGAGTAGAAGG + Intronic
931046998 2:58365432-58365454 TCTGAGAAGAAATAGCTAGAGGG - Intergenic
931553801 2:63477498-63477520 TCTGGGAGGTAGAAGGAAAATGG + Intronic
931631232 2:64301915-64301937 TCTGGGAAGGTGAAGGTTGATGG + Intergenic
932364496 2:71140285-71140307 GCTGAGAAGTCCAAGGTCGAGGG + Intronic
932710025 2:74055936-74055958 TCTGAGAAGTCCAAGGTCAAGGG - Intronic
933884982 2:86711093-86711115 CCTGTGAAGAAGAAGGAAGAAGG - Intronic
933916262 2:86996921-86996943 TATCAAAAGTAGAAGGCAGAGGG + Intronic
933968619 2:87451797-87451819 TCTGGGAAGTCCAAGGTTGAGGG + Intergenic
934006731 2:87772981-87773003 TATCAAAAGTAGAAGGCAGAGGG - Intronic
934052654 2:88223390-88223412 ACTGAGAAGTCCAAGGTCGAGGG - Intergenic
934673047 2:96228847-96228869 TCTCAGAAGTCCAAGGTTGAGGG + Intergenic
935470404 2:103452743-103452765 TCTGAGATGTAGAAACAAGATGG + Intergenic
935624225 2:105156015-105156037 TCTGAAAAGGGGAAGGAAGAAGG + Intergenic
935770381 2:106413904-106413926 TATCAAAAGTAGAAGGCAGAGGG - Intronic
936015545 2:108956294-108956316 TCTGAAGAGTAGAAGTTAAAGGG + Intronic
936325175 2:111498708-111498730 TCTGGGAAGTCCAAGGTTGAGGG - Intergenic
936643947 2:114347834-114347856 GCTGAGAAGTCCAAGGTCGAGGG + Intergenic
936954068 2:118006867-118006889 TGGAAGAAGTGGAAGGTAGATGG + Intronic
937536523 2:122895623-122895645 TCTGAGAGGTAGAAAGTCAATGG + Intergenic
938194192 2:129312164-129312186 TCTAAAATGTAGAAAGTAGAAGG + Intergenic
938564381 2:132505106-132505128 GCTGAGAAATTCAAGGTAGAGGG + Intronic
938599701 2:132824538-132824560 TCTCTGAAGTAGAAGAAAGAAGG + Intronic
938679175 2:133671641-133671663 TCTGGGAAGTCCAAGGTTGAGGG - Intergenic
939176689 2:138757298-138757320 TCTGAGATGTAGAAGGCGTAAGG + Intronic
939456119 2:142437936-142437958 TTTGAGTAGTAGAATGTGGATGG - Intergenic
939935074 2:148281184-148281206 TTTTAGAAATAGAATGTAGAAGG - Intronic
939948795 2:148443700-148443722 TCATAGAAATAGAAAGTAGAAGG + Intronic
940690329 2:156909886-156909908 TCTTAGAAGTAGAAGACGGAAGG + Intergenic
940853905 2:158714964-158714986 TCTGAAAGGTAGAGGGAAGAAGG - Intergenic
940863146 2:158790578-158790600 GCTAAGAAGTCGAAGGTGGAGGG - Intergenic
940906231 2:159172329-159172351 TCTGAGAAGTAGATTGGAAAAGG + Intronic
940971007 2:159896777-159896799 TCTGACATGTAGAACTTAGATGG + Intronic
941341104 2:164304503-164304525 GCTGAGAAGTCCAAGGTTGAGGG - Intergenic
941536640 2:166730425-166730447 ACTGAGAGGAAGAAGGCAGAAGG + Intergenic
941545555 2:166846232-166846254 AATGGGAGGTAGAAGGTAGAAGG + Intergenic
941864456 2:170319837-170319859 TCTGAAAAGTAGAAGTCAGAAGG + Intronic
942064714 2:172259864-172259886 TCTGAAAGGTAAAAGGCAGAAGG + Intergenic
942131316 2:172883230-172883252 GCTGAGAAGTCCAAGGTGGAAGG + Intronic
942305823 2:174606919-174606941 GCTGAGAAGTCCAAGGTCGAGGG + Intronic
943322736 2:186465562-186465584 GCTGAGAAGTCCAAGGTTGAGGG - Intergenic
944032246 2:195249406-195249428 TCACAGAAGCAGAAAGTAGAAGG + Intergenic
944326774 2:198414885-198414907 GCTGAGAAGTCCAAGGTTGAGGG - Intronic
945621280 2:212141991-212142013 TCAGAAAAGTAGCAGATAGATGG - Intronic
945834076 2:214818414-214818436 TTTGAGTAGTAGAAGGGAGGAGG + Intergenic
946311493 2:218884551-218884573 TCTGAGAAGTAGAAGGTAGAAGG - Intronic
946400938 2:219468211-219468233 TCTGAGAAGTAGATGGAGGAGGG + Intronic
946530270 2:220563263-220563285 TCAGAGAGGCAGAAAGTAGACGG + Intergenic
947855157 2:233319027-233319049 GCAGATAAGTAGATGGTAGACGG + Intronic
948575132 2:238945023-238945045 GCTGAGAAGTCCAAGGTTGAGGG + Intergenic
1168908638 20:1427332-1427354 TCTGAAAAGTAAATGGTAGAAGG + Intergenic
1169100058 20:2939741-2939763 TCTGAAAAGTAGAAAAAAGAAGG - Intronic
1169168699 20:3446257-3446279 TCAGAAAACTAGCAGGTAGAGGG + Intergenic
1169248285 20:4041334-4041356 TCTGAGTAGTAGGAGGTGAAAGG + Intergenic
1169674979 20:8143234-8143256 GCTGAGAAGAAGTAGGTAGGAGG - Intronic
1170485152 20:16807980-16808002 TCTGAGAGGAAGAGGGAAGAAGG + Intergenic
1170565066 20:17595302-17595324 TCTGTGAAGTATAAGGCAGGAGG - Intronic
1170631347 20:18068928-18068950 TCATAGAAGGAGAAAGTAGAAGG - Intergenic
1170633160 20:18082435-18082457 CCAGAGAAGTAGAAGGGAGTGGG - Intergenic
1172022172 20:31922482-31922504 TCATAGAGATAGAAGGTAGATGG - Intronic
1172804487 20:37601630-37601652 GCTGAGAAGTCCAAGGTCGAGGG - Intergenic
1173301798 20:41810094-41810116 ACTGAAAAGTAGAAAGAAGAAGG + Intergenic
1174107340 20:48172030-48172052 TCTGGGCAGCAGGAGGTAGAGGG - Intergenic
1174212292 20:48889622-48889644 TCTATGAAGTAGAAGCTACAGGG + Intergenic
1174733841 20:52945083-52945105 GCTGAGGAGGAGAAGGAAGAGGG + Intergenic
1174753532 20:53136033-53136055 GCTGAGAAGTCCAAGGTTGAGGG + Intronic
1175825054 20:61932162-61932184 TCTGAGCAGCAGGAGGGAGATGG - Intronic
1177785173 21:25663742-25663764 GCTGAGAAGTCCAAGGTAGAGGG - Intronic
1177794645 21:25760932-25760954 TCTGAGAATTAGGACTTAGAAGG + Intronic
1178417654 21:32416844-32416866 TGTGAGAAGTAGAAGGGACAGGG + Intronic
1178588276 21:33887902-33887924 TCTCAGAATTAGAAGGTGGCCGG - Intronic
1178597949 21:33972017-33972039 TCTTATAAGAAGAAGGCAGAGGG - Intergenic
1179305091 21:40146289-40146311 TCAGAGAAGTAGAAGGAGGATGG + Intronic
1179986529 21:44924840-44924862 TCTGAAAAGCAAAATGTAGAAGG + Intronic
1180249554 21:46572684-46572706 GCTGAGAAGTCCAAGGTTGAGGG - Intergenic
1180686322 22:17669864-17669886 GCTGAGAAGTCCAAGGTTGAGGG - Intronic
1181896362 22:26111385-26111407 TCTAACAAGTAGAATGTAGTGGG + Intergenic
1182481617 22:30612932-30612954 TCTGAGAGCGAGCAGGTAGAGGG - Exonic
1184139421 22:42569757-42569779 TCTGAGAAGCAGAAAATAGCTGG + Intronic
1184341465 22:43888320-43888342 CCTGAGAGGTAGAAGGGACAAGG + Intronic
1185101911 22:48845141-48845163 TCAGAGATGTAGAAGTAAGAAGG - Intronic
950205803 3:11079575-11079597 GCTGAGAAGTTCAAGGTTGAGGG - Intergenic
950343673 3:12272301-12272323 TCTGAGAAGGATCAGCTAGAAGG - Intergenic
951698637 3:25471933-25471955 CCTGACAATGAGAAGGTAGAGGG - Intronic
952022782 3:29042537-29042559 TCTGAAAAATGGAAGGAAGAAGG - Intergenic
952127976 3:30324439-30324461 TCTCAGAGGTAGCAGGTAGTGGG + Intergenic
952528094 3:34234026-34234048 TCCTAGAAGTAGCACGTAGAAGG + Intergenic
952541557 3:34372863-34372885 TGTGGGAAGAAGAAGGAAGATGG + Intergenic
952606399 3:35152259-35152281 TCTCATAAGTAGAAGCTAAATGG - Intergenic
952676522 3:36037625-36037647 GCTGAGAAGTACAAGGTCAAAGG - Intergenic
952784629 3:37141191-37141213 AGTGAGTGGTAGAAGGTAGAAGG - Intronic
952797204 3:37250936-37250958 TGTTAGAGCTAGAAGGTAGAAGG + Intronic
952899482 3:38100015-38100037 TCTGAGAGATAGAAGGCGGAGGG - Intronic
952933814 3:38379914-38379936 GCTGAGAAGTCCAAGGTTGAGGG + Intronic
953173567 3:40529266-40529288 AGTGAGAAGTAGAAGGAAGAAGG - Intronic
953645041 3:44746068-44746090 GCTAAGAAGTCCAAGGTAGAGGG + Intronic
953685488 3:45074890-45074912 ACTGAGAAGGAGAAGCCAGAGGG + Intergenic
954005457 3:47587041-47587063 TCTCAGAAATGGAAGGGAGAAGG + Exonic
954521897 3:51235611-51235633 TCTGAAAAATATGAGGTAGAAGG - Intronic
956454284 3:69405564-69405586 TACCAGAAGAAGAAGGTAGAAGG + Intronic
956833966 3:73080551-73080573 AATGAGAAGTAGAAGGTGGAGGG - Intergenic
957130972 3:76222260-76222282 ACTGAGAGGCATAAGGTAGAAGG + Intronic
957421778 3:79980468-79980490 TTGGAGAAGTAGTATGTAGATGG - Intergenic
958445308 3:94207696-94207718 GCTGAGAAGTCCAAGGTTGAGGG - Intergenic
958784922 3:98587446-98587468 GCTGAGAAGTCCAAGGTTGAGGG + Intronic
958915888 3:100049664-100049686 GCTGAGAAGGAGGAGGAAGAAGG - Intronic
959010889 3:101074629-101074651 TCTTATAAGTAAAAGGCAGAGGG + Intergenic
959172306 3:102858162-102858184 TGTCAGAAGAAGAAGGAAGAAGG - Intergenic
959407431 3:105977373-105977395 TTGGAGAAGCAGGAGGTAGATGG - Intergenic
961590657 3:127978376-127978398 TCTGAAAAGTAAATGGTAGTGGG + Intronic
961648660 3:128406315-128406337 TCATAGAAGCAGAGGGTAGAAGG + Intronic
962618443 3:137151594-137151616 GCTGAGAAGTTCAAGGTTGAGGG - Intergenic
963646125 3:147917000-147917022 TAAGAGAAGAAGAAGGGAGAAGG - Intergenic
963719738 3:148848846-148848868 GCAGAGCAGTAGAAAGTAGATGG + Intronic
964037833 3:152219921-152219943 TATTAGAAGTAGAAGGCAGACGG + Intergenic
966958158 3:184906607-184906629 TCTTAGGGGTAGAAGGGAGATGG + Intronic
970775107 4:19664318-19664340 TCTGAAAAATAGAAGGTAGATGG + Intergenic
971075226 4:23140351-23140373 TTTGATAAGAAGAAGGTAGATGG - Intergenic
971078773 4:23182729-23182751 GCTGGGAAGTCCAAGGTAGAGGG + Intergenic
971422629 4:26488161-26488183 TCTGAGAATTAGTTGGGAGAAGG - Intronic
972451627 4:39206038-39206060 TCTGAAAAGTAAATGGTAGCAGG + Intronic
973313941 4:48740010-48740032 GCTGAGAAGTCCAAGGTTGAGGG - Intronic
973932482 4:55806994-55807016 TATGAGATAAAGAAGGTAGAGGG + Intergenic
974108379 4:57497529-57497551 TCAGAGAATTAGAATGTATAAGG + Intergenic
975075748 4:70206991-70207013 TCTGTGAAGTTGAAGGTAAATGG - Intergenic
975386046 4:73761401-73761423 GCTGAGAAGTCCAAGGTTGAGGG - Intergenic
975489383 4:74971859-74971881 TCTGAGAAGTTCAAGGTATTGGG + Intronic
976362887 4:84201181-84201203 CCTTAGAAGAGGAAGGTAGAGGG - Intergenic
976468100 4:85394618-85394640 TCTGGGAAGTCCAAGGTTGAGGG + Intergenic
976997552 4:91454427-91454449 CCTTATAAGTAGAAGGTGGAGGG - Intronic
977401724 4:96541125-96541147 TCTGGGAAGGAGAGGGCAGAAGG + Intergenic
977706772 4:100080379-100080401 TCTGGGAAGTTCAAGATAGAGGG + Intergenic
979222873 4:118248944-118248966 AATGAGAAGGAGAAGCTAGAAGG - Intronic
979527654 4:121734302-121734324 GCTGAGAAGTCCAAGGTTGAGGG - Intergenic
979557124 4:122061856-122061878 GCTGAGAAGGAGAAAGAAGAGGG - Intergenic
979805295 4:124962722-124962744 TCTTTGAAGTAGAAGATAAAAGG + Intergenic
980044794 4:127975337-127975359 TCATAGAAGCAGAAAGTAGAAGG - Intronic
980581870 4:134764971-134764993 TCTGAGCAGTTGAATGTAGCTGG + Intergenic
980675570 4:136074903-136074925 TCAAAGAAGTAGCAGGTAGGAGG - Intergenic
980882322 4:138724483-138724505 TCTGAGCAGAAGTAGGTAGCAGG + Intergenic
981239244 4:142455342-142455364 TCTTAGACTTAGAGGGTAGAAGG - Intronic
981516362 4:145613903-145613925 GCTGAGAAGTGCAAGGTTGAGGG - Intergenic
982102655 4:151983311-151983333 TCAGAGAGGCAGAAGATAGAGGG - Intergenic
982479101 4:155887270-155887292 TGTGATAAGTAGAGGGTAGAGGG - Intronic
982530207 4:156531822-156531844 TCTAAGAAGTTGGAGATAGAAGG - Intergenic
982780920 4:159490621-159490643 ACTGAGAAGTCCAAGATAGAAGG - Intergenic
983596886 4:169478915-169478937 ATTCAGAAGTAGAAGGTAAAAGG + Intronic
984227164 4:177049082-177049104 TCAGAGATGTAGAAGTTAAAAGG - Intergenic
984882720 4:184424651-184424673 GCTGAGAAGTCCAAGGTTGAGGG - Intronic
985262983 4:188132004-188132026 ACTCAGAAGCAGAAAGTAGAAGG - Intergenic
985779661 5:1863593-1863615 GCTGAGAAGTGCAAGGTCGAGGG - Intergenic
985779680 5:1863737-1863759 ACTGAGAGGCAGAAGGCAGAAGG + Intergenic
986134170 5:4958814-4958836 TCTGTGAAATGGAAGGAAGAAGG + Intergenic
986221090 5:5769473-5769495 TCTGAGAAGCAGAAGATGAAGGG - Intergenic
986312440 5:6562594-6562616 GCTGAGAAGTCCAAGGTCGAGGG - Intergenic
986761188 5:10881514-10881536 TCTGAAAATTTGAAGATAGAAGG - Intergenic
986850526 5:11807363-11807385 TCTGGGAGGCAGAAGGTAGTAGG - Intronic
987024781 5:13914712-13914734 TCTGAGAAGTAGAAGAGTTAAGG - Intronic
987254174 5:16132245-16132267 GCTGAGAAGGAGAAGGGACACGG + Intronic
987590700 5:19922039-19922061 TCTGAGAATGTGAAGGTGGAGGG + Intronic
987762609 5:22185115-22185137 TGCCAGAAGTAGAAGGGAGAAGG - Intronic
988401065 5:30760951-30760973 TCTGAGAACTAAAAGGTGAAGGG + Intergenic
988629672 5:32915304-32915326 GCTGAGGGGCAGAAGGTAGATGG - Intergenic
988863316 5:35307327-35307349 TATGAGAAGTAGGTGGTACAGGG + Intergenic
989238896 5:39180760-39180782 CTGGAGAAGTAGAAAGTAGATGG - Intronic
989712491 5:44416575-44416597 ACTGAGAAGTCCAAGGTTGAGGG + Intergenic
989824756 5:45839627-45839649 CCTGAGAACCAGTAGGTAGAGGG + Intergenic
990140933 5:52703227-52703249 GATGAGAAGTAGTAGGAAGAAGG - Intergenic
990194932 5:53303911-53303933 ACTGGGAAGTAGAAGATGGAGGG - Intergenic
990486155 5:56261093-56261115 TGTGAGAATGAGAAGGAAGAAGG - Intergenic
990530783 5:56671373-56671395 TCTGGGAAGTCCAAGGTTGAGGG - Intergenic
990532210 5:56685561-56685583 TCATAAAAATAGAAGGTAGAAGG - Intergenic
991503440 5:67300564-67300586 TCTGAGAATTAGAAGGCACAGGG + Intergenic
991897400 5:71418500-71418522 TGCCAGAAGTAGAAGGGAGAAGG - Intergenic
992541154 5:77765543-77765565 TCAGAAAAGTAGGAGGGAGAGGG - Intronic
992904410 5:81332039-81332061 TCTGAGAAGTTCAATGTACATGG + Intronic
992925994 5:81587866-81587888 TCTGTGAAGATGATGGTAGATGG + Intronic
993376372 5:87153688-87153710 TCAGAGAAGTAACAAGTAGATGG + Intergenic
993531521 5:89030448-89030470 CCTCAGAAGTAGAGGGTGGAGGG - Intergenic
993681447 5:90883628-90883650 ACAGAGAAGTAGCAGTTAGAAGG - Intronic
993962285 5:94314087-94314109 TCAGAGAAGTTGAAGGTGGTAGG - Intronic
995889289 5:116933028-116933050 TCTGAGATGTAGAAGTTAACAGG - Intergenic
996030367 5:118698066-118698088 TCAGAGTACTAGAAGGGAGAGGG - Intergenic
996684895 5:126269260-126269282 TTTGACAAGTAGGAGGCAGATGG - Intergenic
996998131 5:129724481-129724503 ACTGAGAAGCATAAGGCAGAAGG + Intronic
997662151 5:135597590-135597612 TTTGAGAAGTAGAAGTGAGGTGG - Intergenic
998515171 5:142747108-142747130 ACTGAGAAGTATAAGCTAAAAGG - Intergenic
998891907 5:146755150-146755172 TCTGAGAAGTGGAGAGGAGAGGG + Intronic
999654676 5:153800178-153800200 GCTCAGAAGGAGTAGGTAGAGGG - Intronic
1000142482 5:158418998-158419020 ACTGAGTAGCAGAAGGAAGAGGG + Intergenic
1000334551 5:160232313-160232335 TTTGAGAAGGAGAAGTCAGATGG - Intronic
1001145013 5:169176252-169176274 CCTGAGAAAAAGAAGGAAGAAGG - Intronic
1002591709 5:180295192-180295214 GCTGAGAAGTCCAAGGTTGAGGG - Intergenic
1002993935 6:2265060-2265082 TCTGACAAGGAGAAGGCATAGGG + Intergenic
1003000520 6:2328014-2328036 TCTCAGAAGAAGAAGGGGGAAGG - Intergenic
1003957703 6:11179444-11179466 CCTGAGAAGTTCAAGGTTGAGGG - Intergenic
1005964894 6:30720337-30720359 TCTGAGAGGGAGAAAGGAGAGGG - Exonic
1007033037 6:38646383-38646405 TCTAAAAAGCAGATGGTAGAGGG - Intergenic
1007837378 6:44684136-44684158 ACTGAGAATTGGAAGATAGAAGG + Intergenic
1008124923 6:47657241-47657263 TCTGAGAAGAAGAATGTGTAAGG - Intronic
1008510023 6:52267483-52267505 GGAGAGAAGTAGAGGGTAGAAGG - Intronic
1009380494 6:63023007-63023029 AATGAGAAGTAGATGGGAGAAGG - Intergenic
1009436370 6:63622885-63622907 ACTGAGAAGTAGAAGGTTTTGGG + Intergenic
1009636146 6:66266618-66266640 GCTGAGAAGTTCAAGATAGAAGG - Intergenic
1009887699 6:69643671-69643693 CCTGAGAAATACAAAGTAGATGG + Intergenic
1011566497 6:88679034-88679056 GCTGAGAAGGAGGAGGAAGAGGG - Intronic
1011781705 6:90796781-90796803 CCTGACAAGTAGGAGGTAGTTGG + Intergenic
1012007302 6:93729638-93729660 ACTGAGAAAGGGAAGGTAGAAGG + Intergenic
1012954784 6:105557882-105557904 TCTGAGAGGTCCAAGGTTGAGGG + Intergenic
1013144269 6:107372396-107372418 TCTGGGAAGTAGGAGGAAAAGGG + Intronic
1013727702 6:113120052-113120074 TCTCATAGCTAGAAGGTAGAAGG - Intergenic
1014760584 6:125352422-125352444 GCTGGGAAGTACAAGGTTGAGGG + Intergenic
1014893764 6:126874117-126874139 ACTGAGGAGTACAAGGTTGAGGG - Intergenic
1015492360 6:133839967-133839989 ACACAGAAGTAGAAGGAAGAAGG - Intergenic
1015927555 6:138325387-138325409 TGTGAGAAACTGAAGGTAGAAGG - Intronic
1015983733 6:138865034-138865056 TCGCAGAAGTAGATGGAAGAGGG - Exonic
1016195342 6:141329502-141329524 TCTGAGGAGAACAAGGGAGAAGG - Intergenic
1016382628 6:143500336-143500358 TATAAGAAGTGGTAGGTAGATGG + Intronic
1017809063 6:157971018-157971040 GCTGAGATGAAGGAGGTAGAGGG + Intergenic
1019874248 7:3794686-3794708 TCTGAGAAGTCCAAGGTCGAGGG - Intronic
1020741736 7:12028501-12028523 TCTTAAAAGTGAAAGGTAGAGGG + Intergenic
1021246376 7:18267477-18267499 TCATAGAAGTAGAGAGTAGAAGG - Intronic
1021332720 7:19358462-19358484 GCTGAGAAGTCCAAGGTGGAGGG - Intergenic
1021938197 7:25652484-25652506 TCTGAGAAGTAACTGGTAGGTGG + Intergenic
1021983338 7:26076037-26076059 TCTGAGAAGTGGTAGTTACACGG + Intergenic
1022197749 7:28085034-28085056 GCTGAGAAGTCCAAGGTTGAGGG - Intronic
1023097957 7:36681958-36681980 TCTGTGAGGGAGAAAGTAGAGGG + Intronic
1023115579 7:36858681-36858703 TCAGAGAAGTGAGAGGTAGAGGG + Intronic
1023625770 7:42113834-42113856 TCTCAGAACTAGAAGGGAAAGGG - Intronic
1023684309 7:42719056-42719078 TCTGAGGAGCATAAGGCAGAAGG + Intergenic
1023689315 7:42769949-42769971 GCTTGGAAGGAGAAGGTAGAGGG - Intergenic
1024127281 7:46312432-46312454 GCTGAGAAGGAAAAGGAAGAGGG + Intergenic
1024467327 7:49725361-49725383 GCTGAGAAGTCCAAGGTTGAGGG - Intergenic
1026098662 7:67367009-67367031 TTAGAGATGCAGAAGGTAGAAGG + Intergenic
1026423059 7:70260430-70260452 GCTGAAAAGTCTAAGGTAGAGGG + Intronic
1027887589 7:83929343-83929365 TATTATAAGTAGAAGGTAGGTGG - Intergenic
1029015129 7:97308371-97308393 TTTTACATGTAGAAGGTAGAAGG - Intergenic
1029903501 7:104067408-104067430 TTTGAGAAATAGAAGGTAGTTGG + Intergenic
1030803464 7:113884317-113884339 TCTGAGAAATAGCAGGGAGGAGG + Intronic
1031878373 7:127167739-127167761 TCTGAGAAGAAGGAGGGAGATGG - Intronic
1033557155 7:142498859-142498881 ACTGAGAAGTCCAAGATAGAAGG - Intergenic
1033647120 7:143313996-143314018 TCATAGAAGCAGAAAGTAGAGGG - Intergenic
1034727465 7:153351026-153351048 TCTGAAAGGTAGAGGGGAGAAGG - Intergenic
1034735804 7:153428483-153428505 TCTGAGTAGTAGAAGAAACATGG + Intergenic
1034906929 7:154957607-154957629 TTTGAGAAGTTCAAGGTTGAGGG - Intronic
1034975127 7:155444176-155444198 TCATAGAAGCAGAAAGTAGAAGG + Intergenic
1035360275 7:158308021-158308043 GCTGAGAAGTTCAAGGTTGAGGG - Intronic
1035879784 8:3233404-3233426 GCTGAGAAGTCCAAGGTCGAGGG - Intronic
1036535184 8:9643288-9643310 GCTGAGAAGTCCAAGGTTGAGGG + Intronic
1036782803 8:11661198-11661220 TCGGAGGAGTAGAGGGGAGACGG + Intergenic
1037236046 8:16720531-16720553 TCTGAGCAGCACAAGGCAGAAGG - Intergenic
1038820122 8:30944383-30944405 TTTGAGAAGTAGGAGGGAAATGG - Intergenic
1039444798 8:37622447-37622469 TCTGAGAAATGGAAAGTAGAGGG - Intergenic
1039449790 8:37663256-37663278 GATGAGAAGTATAAGGTAAAGGG + Intergenic
1041321526 8:56618740-56618762 TCTGAGAGACAGAAGGAAGAAGG - Intergenic
1041358838 8:57029115-57029137 ACTGAGAAGTCTAAGGTTGAGGG - Intergenic
1041428658 8:57752618-57752640 TTAGAGAAGTTAAAGGTAGAGGG + Intergenic
1041758677 8:61340373-61340395 TCACAGAAGTAGACAGTAGAAGG - Intronic
1041785195 8:61623978-61624000 TCACAGAGGTAGAGGGTAGAAGG + Intronic
1041867995 8:62598744-62598766 TCAGAGAAGTAGGAGGCAGGAGG + Intronic
1041926587 8:63243219-63243241 GCTGAGAGGAAGAAGGTAAAGGG - Intergenic
1043050589 8:75380537-75380559 TCTGAGAAGTTCAAGGACGAGGG - Intergenic
1043105584 8:76106134-76106156 TCTGAGGAGGAGAAGGTAAGAGG - Intergenic
1043228586 8:77768570-77768592 TCTGAGAAGTAATAAGTAAAGGG - Intergenic
1043364579 8:79517798-79517820 GCTGAGAAGGAGAAGGCAGAGGG + Intergenic
1043571834 8:81612539-81612561 GCTGAGAAGTCCAAGGTCGAGGG - Intergenic
1044076859 8:87832369-87832391 TCTTAGAAGAAGATGCTAGAGGG - Intergenic
1044194238 8:89355109-89355131 TCATAGAAGTAGCAAGTAGAAGG + Intergenic
1044288659 8:90441163-90441185 TCTGAGATGTAGAAGGAAAAAGG - Intergenic
1044695862 8:94921823-94921845 TCTGTGAAATAGGAGGCAGAAGG + Intronic
1045085872 8:98684619-98684641 TCTGTGAAGTAGATGGATGAGGG + Intronic
1045154210 8:99448935-99448957 TCAGAGAAGTAGAATGGAAAGGG - Intronic
1045186265 8:99841657-99841679 ACTGAGAAGCAGTAGGCAGAAGG - Intronic
1045348892 8:101320057-101320079 GCTGAGAAGTCCAAGGTCGAGGG + Intergenic
1045427156 8:102078351-102078373 TGTGAAAAATAGAATGTAGAGGG - Intronic
1046304448 8:112345539-112345561 ACTCAGGAGTAGAAAGTAGAAGG + Intronic
1046644595 8:116771813-116771835 TCTGAGAAGCAGAATGCAGAAGG + Exonic
1046754663 8:117961014-117961036 TGTGGGAAGTAGAGGGTAAATGG + Intronic
1046764070 8:118050866-118050888 TCTAAGAATTAGAAGGTGGAGGG + Intronic
1047219050 8:122903982-122904004 CCTGAAAAGTGGAAGGAAGAAGG + Intronic
1048151687 8:131900992-131901014 TCTCAGAAGTAGGGGGTAGGGGG + Intergenic
1048535354 8:135289212-135289234 TCTGATAAAAAGAAGGAAGAAGG + Intergenic
1048722808 8:137346055-137346077 TCTTATAAGTGGAAGATAGAAGG - Intergenic
1049368883 8:142254079-142254101 TCTGCCAAGAAGAAGGTGGAAGG - Intronic
1051146578 9:14033430-14033452 ACTGAGAAGTAGCTGGGAGAAGG + Intergenic
1051224642 9:14886022-14886044 TCATAGAAGTAGAGAGTAGAAGG - Intronic
1053352708 9:37424136-37424158 ACTGAGCAGGAGAAGGTGGAAGG + Intronic
1053590637 9:39510999-39511021 TCTGAGAACGGGGAGGTAGAAGG - Intergenic
1053848497 9:42266388-42266410 TCTGAGAACAGGGAGGTAGAAGG - Intergenic
1054575667 9:66854290-66854312 TCTGAGAACGGGGAGGTAGAAGG + Intergenic
1054741763 9:68813170-68813192 TCTCAGAAGTGGCATGTAGATGG - Intronic
1054781815 9:69173179-69173201 GCTCACAAGTAGAAGGTAAAAGG - Intronic
1054857824 9:69919855-69919877 TCTCTGAAGTAGAAGGTAGCAGG - Intergenic
1055624982 9:78167374-78167396 TCTAAGAAGTAGAACTAAGAAGG - Intergenic
1056684497 9:88748390-88748412 TCTTAGAAGCAGAAAGTAGAAGG - Intergenic
1056746288 9:89306587-89306609 GCTGGGAAGTCAAAGGTAGAGGG - Intergenic
1057296231 9:93844398-93844420 GCTCAGAAGTCTAAGGTAGAAGG - Intergenic
1057392454 9:94651156-94651178 TCTGTCAAGTAGGAGGTAGGGGG - Intergenic
1057970601 9:99553821-99553843 TGAGAAAACTAGAAGGTAGAGGG + Intergenic
1058366133 9:104210563-104210585 GCTGAGAAGTCCAAGGTTGAGGG - Intergenic
1058610107 9:106766732-106766754 TCTGAGAAGTAGAATGGGTATGG + Intergenic
1059259398 9:112961500-112961522 TGGGAGAAGCAGGAGGTAGAGGG - Intergenic
1060128907 9:121076327-121076349 TCTGAGCAGAAGAAGAGAGATGG + Intronic
1060337476 9:122739361-122739383 GCTGAGAAGTCCAAGGTCGAGGG + Intergenic
1060911368 9:127353912-127353934 TCTGAGAACCAGAAGGTCCAGGG - Exonic
1061229075 9:129301952-129301974 TCTGAAAGGTAGAAAGAAGAAGG - Intergenic
1186194680 X:7098774-7098796 TCTGAGAGGGGGAAAGTAGAGGG + Intronic
1186311238 X:8322084-8322106 TTCTAGAAGTAGAAAGTAGATGG + Intergenic
1186809558 X:13174853-13174875 GCTGAGAAGTTCAAGGTGGAGGG + Intergenic
1187203121 X:17155159-17155181 GCTGAGAAGTCCAAGGTCGAGGG + Intergenic
1187789166 X:22929810-22929832 TCTGGGAATTAGAAAGCAGATGG - Intergenic
1188265534 X:28068595-28068617 TCAGGGAAATAGAAAGTAGAAGG - Intergenic
1188611365 X:32102175-32102197 GCTGAGAAGTCCAAGGTTGAGGG - Intronic
1188959379 X:36471333-36471355 TCATAGAAGTAAAGGGTAGATGG + Intergenic
1189052660 X:37663046-37663068 TGAGAGATGTAGAAGGAAGAAGG - Intronic
1189887814 X:45566875-45566897 CCATAGAAATAGAAGGTAGAAGG + Intergenic
1190139947 X:47833936-47833958 GCTGAGAAGTCCAAGGTTGAAGG - Intergenic
1190384255 X:49869001-49869023 TCTGAAAAGTAGATAGTATAAGG - Intergenic
1190571316 X:51784967-51784989 TCTGAAAGGTAGAAAGAAGAAGG - Intergenic
1190795442 X:53736941-53736963 TCTGAAAAGTAGAAAGAAGAAGG + Intergenic
1191663216 X:63671514-63671536 TGTGAGAGGCAGAAGGTTGAAGG + Intronic
1191699884 X:64030326-64030348 TCCCAGAAGAAGAAGGGAGAGGG - Intergenic
1192056172 X:67776094-67776116 TCTGATAAGTAGGAGATAAATGG + Intergenic
1192847008 X:74916641-74916663 GCTGAAAAGTTCAAGGTAGAGGG - Intronic
1193738509 X:85188882-85188904 TATGAGAACTAGAAGTGAGAAGG - Intergenic
1194405563 X:93492426-93492448 ACTGAGAAGTCCAAGGTTGAGGG + Intergenic
1194428948 X:93776657-93776679 TTTGAGAAAAAGTAGGTAGAGGG + Intergenic
1194737196 X:97526599-97526621 TTAGAGATGGAGAAGGTAGAAGG - Intronic
1197282402 X:124552684-124552706 TCTGAGAGGTAAGAGGGAGATGG - Intronic
1197715870 X:129705663-129705685 TCTGAGAAGTAGACATCAGATGG - Intergenic
1198319621 X:135506808-135506830 GCTGAGAAGTCCAAGGTTGAGGG - Intergenic
1198564495 X:137890354-137890376 GCTGAGAACTTAAAGGTAGAAGG - Intergenic
1198688423 X:139252607-139252629 TCTGAAAAGTAGATAGTAGCAGG + Intergenic
1199033981 X:143030663-143030685 TCAGAGAAGTGTATGGTAGATGG + Intronic
1199082402 X:143591517-143591539 ACTGAGAGGCATAAGGTAGAAGG + Intergenic
1199372134 X:147062237-147062259 TTATAGAAGTAGAGGGTAGAGGG + Intergenic
1199384804 X:147211439-147211461 TCTTATAAGTAGAAGGAAGGTGG - Intergenic
1199997589 X:153035807-153035829 GCTGAGAAGTCCAAGGTAAAGGG - Intergenic
1200791752 Y:7305369-7305391 TCCCTGTAGTAGAAGGTAGAAGG + Intergenic