ID: 946313023

View in Genome Browser
Species Human (GRCh38)
Location 2:218893284-218893306
Sequence GGACCTCGATCAGGGCCCAG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 109}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946313023_946313035 9 Left 946313023 2:218893284-218893306 CCCCTGGGCCCTGATCGAGGTCC 0: 1
1: 0
2: 0
3: 11
4: 109
Right 946313035 2:218893316-218893338 GCCTGGCCCTCTGAGGCTTACGG 0: 1
1: 0
2: 1
3: 20
4: 251
946313023_946313038 15 Left 946313023 2:218893284-218893306 CCCCTGGGCCCTGATCGAGGTCC 0: 1
1: 0
2: 0
3: 11
4: 109
Right 946313038 2:218893322-218893344 CCCTCTGAGGCTTACGGTCTTGG 0: 1
1: 0
2: 0
3: 10
4: 93
946313023_946313040 20 Left 946313023 2:218893284-218893306 CCCCTGGGCCCTGATCGAGGTCC 0: 1
1: 0
2: 0
3: 11
4: 109
Right 946313040 2:218893327-218893349 TGAGGCTTACGGTCTTGGCAAGG 0: 1
1: 0
2: 0
3: 2
4: 92
946313023_946313029 -8 Left 946313023 2:218893284-218893306 CCCCTGGGCCCTGATCGAGGTCC 0: 1
1: 0
2: 0
3: 11
4: 109
Right 946313029 2:218893299-218893321 CGAGGTCCCCTCCTGGAGCCTGG 0: 1
1: 0
2: 3
3: 24
4: 231
946313023_946313033 2 Left 946313023 2:218893284-218893306 CCCCTGGGCCCTGATCGAGGTCC 0: 1
1: 0
2: 0
3: 11
4: 109
Right 946313033 2:218893309-218893331 TCCTGGAGCCTGGCCCTCTGAGG 0: 1
1: 0
2: 12
3: 51
4: 487

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946313023 Original CRISPR GGACCTCGATCAGGGCCCAG GGG (reversed) Exonic