ID: 946313077

View in Genome Browser
Species Human (GRCh38)
Location 2:218893515-218893537
Sequence CCCAGCCCAACTGAACTGTC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 108}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946313077_946313083 12 Left 946313077 2:218893515-218893537 CCAGACAGTTCAGTTGGGCTGGG 0: 1
1: 0
2: 1
3: 11
4: 108
Right 946313083 2:218893550-218893572 CCCTAAAACAAGCCTCAGCCAGG 0: 1
1: 0
2: 3
3: 24
4: 198

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946313077 Original CRISPR CCCAGCCCAACTGAACTGTC TGG (reversed) Exonic
900573541 1:3371789-3371811 CCCAGCCCATCTGCCCTTTCTGG + Intronic
902090770 1:13901431-13901453 CCCAGCTCACCTGACCTGTCCGG - Intergenic
902196820 1:14804173-14804195 CCCTGCCCAACAGAATTGCCAGG - Intronic
905010111 1:34741601-34741623 CCCAGCCCAACTATAGTCTCTGG + Intronic
905010140 1:34741733-34741755 CCCAGCCCAACTGTAGTCTCTGG + Intronic
910046609 1:82925300-82925322 CACAGTCAAACTGAACTGCCTGG - Intergenic
912976171 1:114332262-114332284 CACAGACCATCTGAACAGTCAGG - Intergenic
913241793 1:116836077-116836099 CCAAGCCCAGCAGAAATGTCAGG + Intergenic
914889284 1:151608326-151608348 TCCAGTCCTACTGAACTGTGTGG + Intergenic
915888179 1:159745788-159745810 CTCAGGCCAAATAAACTGTCTGG + Intergenic
916019899 1:160782485-160782507 CACAGCCCAACTGTGCTGTTGGG - Intergenic
917471071 1:175326416-175326438 CCCACCACAACTTAACTCTCAGG + Intronic
920215930 1:204361594-204361616 CCCTGCCCAGCTGAGATGTCAGG + Intronic
924749535 1:246872956-246872978 TCCAGACCAACTAAACTGTTTGG + Intronic
1066478082 10:35767325-35767347 CTCAGGCCATCTGAACTCTCAGG - Intergenic
1068966422 10:62916430-62916452 CCCAACCCAGCTGCATTGTCAGG + Intronic
1071159992 10:82734506-82734528 CTGAGCCCAACTGAAGTATCAGG - Intronic
1072563442 10:96597890-96597912 CCCACCCCAACTGCACAGTGTGG - Intronic
1074287380 10:112110796-112110818 CCCCGCCCACCAGAAATGTCGGG - Intergenic
1076068993 10:127471013-127471035 GCCAGCCCATCTGAACTGCAGGG - Intergenic
1076481280 10:130786688-130786710 CCCATCCCATCTGAACTGCCTGG + Intergenic
1077985760 11:7349495-7349517 CGCAGCCCACCTCAACTGGCTGG - Intronic
1080528847 11:33154171-33154193 CTCAGCCCCACTGAACAGTTAGG + Intronic
1082109478 11:48258509-48258531 GCCAGCCAAACTGCACTGCCAGG - Intergenic
1084340020 11:68491643-68491665 CCCAGCCCATTTTAACTGTTTGG + Intronic
1089139531 11:116274813-116274835 CCCAGCCTAAGTGAAATCTCTGG + Intergenic
1093756038 12:22853183-22853205 CCCAGCCCAGCTGAATTGGCAGG - Intergenic
1094230445 12:28096653-28096675 AGCAGCCCAACTGAAAAGTCAGG - Intergenic
1096079589 12:48824798-48824820 TCCTGCCCAAGTGAACTGTGTGG + Intronic
1107746352 13:43514474-43514496 CCCAGCTCAACTGATGTGTTTGG - Intronic
1109154783 13:58893830-58893852 AACAGCCAAACTGAACTGTAAGG - Intergenic
1109675986 13:65676103-65676125 CCCTGCCCAACTGTACACTCAGG - Intergenic
1119851213 14:77867910-77867932 CCCAGCCAAAGTGCACTGCCTGG + Intronic
1121227044 14:92328714-92328736 CCCAGCCCAACAGAACTTCCTGG - Intronic
1122008025 14:98721869-98721891 CCCAGCCTTGCTGAACTGTGAGG + Intergenic
1125672684 15:41485303-41485325 CCCAGCCCAAGTGGAGTTTCTGG - Intergenic
1126684010 15:51231579-51231601 CCCAGCCCACTTCAACTGCCAGG - Intronic
1128248542 15:66149284-66149306 CCAAGCCCATCTAGACTGTCTGG - Intronic
1134084567 16:11347448-11347470 CCCTTCCCAACTGAGCTGCCTGG + Intronic
1134762000 16:16722797-16722819 CCCAGCACAACTAAACAGCCTGG - Intergenic
1134984058 16:18636373-18636395 CCCAGCACAACTAAACAGCCTGG + Intergenic
1136230897 16:28884648-28884670 CCCAGGCCAGCAGACCTGTCAGG - Exonic
1138016049 16:53429726-53429748 CCCTGCCCAACTGAAATCTGTGG - Intergenic
1138585116 16:57964326-57964348 CTCAGCTCAACTGAAGTCTCTGG + Intronic
1139472393 16:67185126-67185148 CCCAACCCACCTGAACCGTGGGG + Exonic
1145873691 17:28299063-28299085 CCCCTCCCAAATGAACTGCCAGG + Intergenic
1147325932 17:39669619-39669641 CCCTGCCCAGGTGAAGTGTCCGG + Exonic
1148009633 17:44466545-44466567 CCCCTCCTAACTGAACTGCCAGG + Intronic
1149640639 17:58200262-58200284 CCCTGCCAAGCTGAACCGTCAGG + Exonic
1150290605 17:63979350-63979372 CCCAGCCCACCTGCCCTGTGAGG - Intergenic
1152318751 17:79596256-79596278 CAGAGCCCAACTGAACCCTCAGG + Intergenic
1153810118 18:8744944-8744966 GCCAGCCCCCCTGAGCTGTCCGG + Intronic
1153884921 18:9456239-9456261 CCCAGCCATTCTGAACTGTGAGG - Intergenic
1157580252 18:48769967-48769989 CCCACCCAAACTGAACAGTCAGG - Intronic
1158512760 18:58106189-58106211 CACTGCCCAAATCAACTGTCAGG + Intronic
1160605560 18:80047031-80047053 CCCAGCCCCTGTGAGCTGTCAGG + Intronic
1162676080 19:12299311-12299333 CCCTGCCAAACTGAACAGTGTGG - Intergenic
1164783942 19:30914476-30914498 CCCAGCCCCAGTGAGCTCTCTGG - Intergenic
1166052811 19:40270510-40270532 CCTAGCCCATCTGTGCTGTCTGG - Intronic
1166314265 19:41980024-41980046 CCCAGCCCCTCTGCACTGGCTGG + Intronic
1167244121 19:48363684-48363706 CCCAGGCCAACTGAGCAGTGTGG - Intronic
925574202 2:5343784-5343806 CCGAGCCCAACTCTACTCTCAGG - Intergenic
926391838 2:12401895-12401917 CCCAGCCATGCTGAACTGTGAGG + Intergenic
927408276 2:22796937-22796959 CCCAGCTCCACTGAACCTTCTGG + Intergenic
933547993 2:83739671-83739693 CCCAGCCATGCTGAACTGTGGGG - Intergenic
933970205 2:87463876-87463898 CCCAGCCCAAGGGAACCCTCAGG - Intergenic
934919287 2:98329901-98329923 CCCAGCCAAAGTGAAATGTGTGG - Intergenic
936323576 2:111486620-111486642 CCCAGCCCAAGGGAACCCTCAGG + Intergenic
938644729 2:133318991-133319013 CCCAGGCCCACTGAACTCTGGGG + Intronic
939075203 2:137593010-137593032 CACAGCCCAAAAGAACTGTGTGG - Intronic
939961586 2:148570280-148570302 CCCAGCCATGCTGAACTGTGAGG - Intergenic
943000622 2:182323905-182323927 CACAGCCCTACTGCAATGTCAGG - Intronic
944933298 2:204542952-204542974 CCCTGCCTAACTAAAATGTCAGG - Intergenic
946108906 2:217396796-217396818 CCCAGCCCAACATAAATGCCTGG + Intronic
946313077 2:218893515-218893537 CCCAGCCCAACTGAACTGTCTGG - Exonic
947404975 2:229765921-229765943 CACTGCCCAAGTGAACTCTCAGG + Intronic
948541270 2:238692873-238692895 CCCAGCCCAGCTCAACTGCCCGG - Intergenic
1169275714 20:4232508-4232530 CCCAGCCCTTCTGAGCAGTCTGG - Intronic
1170315383 20:15035546-15035568 CCCCACCCATCTGCACTGTCAGG + Intronic
1172032066 20:31989283-31989305 CCCAGCGCATCTGGAGTGTCAGG + Intronic
1176246935 20:64101990-64102012 CCCAGCCCACCTCTGCTGTCGGG + Intergenic
1178030813 21:28523437-28523459 CCCAAACCAACTGAACAGCCAGG + Intergenic
1180021445 21:45130643-45130665 CTCAGCCTCACTGCACTGTCTGG + Intronic
1182343372 22:29642897-29642919 CCAAGCCCACTTGAGCTGTCTGG + Intronic
949980699 3:9500334-9500356 CCCAGGCCGACTGGACTGTCCGG + Exonic
951117786 3:18885788-18885810 CCCAGCCCAGCTGAGCTGGCAGG - Intergenic
953189175 3:40667678-40667700 CCCAGACCTACTGAACTCTGGGG + Intergenic
954457386 3:50607280-50607302 CCCTGGCCACCTGAACTGTATGG - Exonic
959741890 3:109730077-109730099 CTCATACCACCTGAACTGTCAGG - Intergenic
967812522 3:193772739-193772761 CCCAGCCCTCCTAGACTGTCTGG + Intergenic
974384667 4:61189368-61189390 CCCAGCCCAACATAACTTTTGGG - Intergenic
975304135 4:72828809-72828831 CCAAGACCAACAAAACTGTCTGG + Intergenic
983725617 4:170920816-170920838 GCAAGGCCAACTTAACTGTCTGG + Intergenic
985230818 4:187814633-187814655 TCCATCCCAACAGAAATGTCAGG + Intergenic
986195553 5:5534100-5534122 CCCAGCCCGCCTGAACTGGCAGG + Intergenic
988963645 5:36393623-36393645 CCCAGCCCCAGTAAACTGTGTGG + Intergenic
996388828 5:122938096-122938118 CACAGCCCAGCTGTACTCTCCGG + Intronic
996510453 5:124309905-124309927 TCTAGCCCAACTGAACTGTCTGG - Intergenic
997850781 5:137331046-137331068 CCTAGCCTAACTGAACTTCCTGG + Intronic
997863268 5:137438749-137438771 CTCAGCCAAAATGAACTGGCAGG + Intronic
1000184550 5:158846469-158846491 CCCAGCCCACCTGAGCTGCCAGG + Intronic
1002800372 6:516429-516451 CCCGGCCCAACAGAGCTGTGTGG + Intronic
1007476158 6:42121479-42121501 CCCTGCCCTCCTGAACTCTCAGG - Intronic
1016366805 6:143327474-143327496 CCAGGCCCAACAAAACTGTCTGG + Intronic
1026378237 7:69773610-69773632 CACAGCCCAGCTGCACTGGCAGG - Intronic
1033799483 7:144882920-144882942 CCCAGCACAACTGAATTGAGGGG - Intergenic
1036699454 8:11002387-11002409 CCCAGGCCAACAGAACTGCTGGG - Intronic
1041935851 8:63331106-63331128 CCCAGCCACACTTCACTGTCAGG - Intergenic
1041968232 8:63705545-63705567 GCCTGCCCAGCTCAACTGTCAGG - Intergenic
1042440240 8:68817741-68817763 CCCAGCCATGCTGAACTGTGAGG - Intronic
1043598629 8:81914264-81914286 CCCATCCCACCAGAAATGTCAGG + Intergenic
1044345361 8:91098288-91098310 CCCAGCCCACATGTACTGCCTGG - Intergenic
1047851920 8:128866218-128866240 CCCAGGCAACCTGAACTTTCTGG + Intergenic
1053057414 9:35001937-35001959 ACCTGCCCAAGTGAACTTTCAGG + Intergenic
1056475953 9:86951049-86951071 TCCAGCCCAGCTGAACCTTCAGG + Intergenic
1061293892 9:129666800-129666822 CCCTCCCCCACTGAACCGTCCGG - Intronic
1189047046 X:37604510-37604532 CCCAGCTCAGCAGAACTATCAGG - Intronic
1191879692 X:65832959-65832981 CCCAGCTTGACAGAACTGTCCGG + Intergenic
1192305968 X:69959921-69959943 CCCAGCCACACTGATCTTTCTGG - Intronic
1194714189 X:97271684-97271706 CCAAGGCCAACTGAAAGGTCAGG - Intronic
1201430895 Y:13901010-13901032 CCCTGTCCAACAGAACTGGCGGG - Intergenic