ID: 946315886

View in Genome Browser
Species Human (GRCh38)
Location 2:218911935-218911957
Sequence TCAGAGTTGTAGGCCAGGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946315881_946315886 10 Left 946315881 2:218911902-218911924 CCCATTTAAAATGTGCAGTTCAA No data
Right 946315886 2:218911935-218911957 TCAGAGTTGTAGGCCAGGTGTGG No data
946315882_946315886 9 Left 946315882 2:218911903-218911925 CCATTTAAAATGTGCAGTTCAAT No data
Right 946315886 2:218911935-218911957 TCAGAGTTGTAGGCCAGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946315886 Original CRISPR TCAGAGTTGTAGGCCAGGTG TGG Intergenic
No off target data available for this crispr