ID: 946317533

View in Genome Browser
Species Human (GRCh38)
Location 2:218927349-218927371
Sequence AGGGCTTGGAATTTCTAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946317533_946317542 19 Left 946317533 2:218927349-218927371 CCCCTCTAGAAATTCCAAGCCCT No data
Right 946317542 2:218927391-218927413 CATTCACATGATGCAGCCGTGGG No data
946317533_946317538 -4 Left 946317533 2:218927349-218927371 CCCCTCTAGAAATTCCAAGCCCT No data
Right 946317538 2:218927368-218927390 CCCTGAATTGCAGAGCAGCCAGG No data
946317533_946317543 20 Left 946317533 2:218927349-218927371 CCCCTCTAGAAATTCCAAGCCCT No data
Right 946317543 2:218927392-218927414 ATTCACATGATGCAGCCGTGGGG No data
946317533_946317541 18 Left 946317533 2:218927349-218927371 CCCCTCTAGAAATTCCAAGCCCT No data
Right 946317541 2:218927390-218927412 GCATTCACATGATGCAGCCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946317533 Original CRISPR AGGGCTTGGAATTTCTAGAG GGG (reversed) Intergenic
No off target data available for this crispr