ID: 946317535

View in Genome Browser
Species Human (GRCh38)
Location 2:218927351-218927373
Sequence TCAGGGCTTGGAATTTCTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946317535_946317543 18 Left 946317535 2:218927351-218927373 CCTCTAGAAATTCCAAGCCCTGA No data
Right 946317543 2:218927392-218927414 ATTCACATGATGCAGCCGTGGGG No data
946317535_946317542 17 Left 946317535 2:218927351-218927373 CCTCTAGAAATTCCAAGCCCTGA No data
Right 946317542 2:218927391-218927413 CATTCACATGATGCAGCCGTGGG No data
946317535_946317541 16 Left 946317535 2:218927351-218927373 CCTCTAGAAATTCCAAGCCCTGA No data
Right 946317541 2:218927390-218927412 GCATTCACATGATGCAGCCGTGG No data
946317535_946317538 -6 Left 946317535 2:218927351-218927373 CCTCTAGAAATTCCAAGCCCTGA No data
Right 946317538 2:218927368-218927390 CCCTGAATTGCAGAGCAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946317535 Original CRISPR TCAGGGCTTGGAATTTCTAG AGG (reversed) Intergenic
No off target data available for this crispr