ID: 946317538

View in Genome Browser
Species Human (GRCh38)
Location 2:218927368-218927390
Sequence CCCTGAATTGCAGAGCAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946317533_946317538 -4 Left 946317533 2:218927349-218927371 CCCCTCTAGAAATTCCAAGCCCT No data
Right 946317538 2:218927368-218927390 CCCTGAATTGCAGAGCAGCCAGG No data
946317534_946317538 -5 Left 946317534 2:218927350-218927372 CCCTCTAGAAATTCCAAGCCCTG No data
Right 946317538 2:218927368-218927390 CCCTGAATTGCAGAGCAGCCAGG No data
946317535_946317538 -6 Left 946317535 2:218927351-218927373 CCTCTAGAAATTCCAAGCCCTGA No data
Right 946317538 2:218927368-218927390 CCCTGAATTGCAGAGCAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946317538 Original CRISPR CCCTGAATTGCAGAGCAGCC AGG Intergenic
No off target data available for this crispr