ID: 946317539

View in Genome Browser
Species Human (GRCh38)
Location 2:218927369-218927391
Sequence GCCTGGCTGCTCTGCAATTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946317539_946317543 0 Left 946317539 2:218927369-218927391 CCTGAATTGCAGAGCAGCCAGGC No data
Right 946317543 2:218927392-218927414 ATTCACATGATGCAGCCGTGGGG No data
946317539_946317546 29 Left 946317539 2:218927369-218927391 CCTGAATTGCAGAGCAGCCAGGC No data
Right 946317546 2:218927421-218927443 ATGTAGAGATGCAATTTGGCAGG No data
946317539_946317541 -2 Left 946317539 2:218927369-218927391 CCTGAATTGCAGAGCAGCCAGGC No data
Right 946317541 2:218927390-218927412 GCATTCACATGATGCAGCCGTGG No data
946317539_946317545 25 Left 946317539 2:218927369-218927391 CCTGAATTGCAGAGCAGCCAGGC No data
Right 946317545 2:218927417-218927439 TTCTATGTAGAGATGCAATTTGG No data
946317539_946317542 -1 Left 946317539 2:218927369-218927391 CCTGAATTGCAGAGCAGCCAGGC No data
Right 946317542 2:218927391-218927413 CATTCACATGATGCAGCCGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946317539 Original CRISPR GCCTGGCTGCTCTGCAATTC AGG (reversed) Intergenic
No off target data available for this crispr