ID: 946317541

View in Genome Browser
Species Human (GRCh38)
Location 2:218927390-218927412
Sequence GCATTCACATGATGCAGCCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946317537_946317541 -1 Left 946317537 2:218927368-218927390 CCCTGAATTGCAGAGCAGCCAGG No data
Right 946317541 2:218927390-218927412 GCATTCACATGATGCAGCCGTGG No data
946317534_946317541 17 Left 946317534 2:218927350-218927372 CCCTCTAGAAATTCCAAGCCCTG No data
Right 946317541 2:218927390-218927412 GCATTCACATGATGCAGCCGTGG No data
946317539_946317541 -2 Left 946317539 2:218927369-218927391 CCTGAATTGCAGAGCAGCCAGGC No data
Right 946317541 2:218927390-218927412 GCATTCACATGATGCAGCCGTGG No data
946317535_946317541 16 Left 946317535 2:218927351-218927373 CCTCTAGAAATTCCAAGCCCTGA No data
Right 946317541 2:218927390-218927412 GCATTCACATGATGCAGCCGTGG No data
946317536_946317541 4 Left 946317536 2:218927363-218927385 CCAAGCCCTGAATTGCAGAGCAG No data
Right 946317541 2:218927390-218927412 GCATTCACATGATGCAGCCGTGG No data
946317533_946317541 18 Left 946317533 2:218927349-218927371 CCCCTCTAGAAATTCCAAGCCCT No data
Right 946317541 2:218927390-218927412 GCATTCACATGATGCAGCCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946317541 Original CRISPR GCATTCACATGATGCAGCCG TGG Intergenic
No off target data available for this crispr