ID: 946317542

View in Genome Browser
Species Human (GRCh38)
Location 2:218927391-218927413
Sequence CATTCACATGATGCAGCCGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946317533_946317542 19 Left 946317533 2:218927349-218927371 CCCCTCTAGAAATTCCAAGCCCT No data
Right 946317542 2:218927391-218927413 CATTCACATGATGCAGCCGTGGG No data
946317539_946317542 -1 Left 946317539 2:218927369-218927391 CCTGAATTGCAGAGCAGCCAGGC No data
Right 946317542 2:218927391-218927413 CATTCACATGATGCAGCCGTGGG No data
946317534_946317542 18 Left 946317534 2:218927350-218927372 CCCTCTAGAAATTCCAAGCCCTG No data
Right 946317542 2:218927391-218927413 CATTCACATGATGCAGCCGTGGG No data
946317535_946317542 17 Left 946317535 2:218927351-218927373 CCTCTAGAAATTCCAAGCCCTGA No data
Right 946317542 2:218927391-218927413 CATTCACATGATGCAGCCGTGGG No data
946317537_946317542 0 Left 946317537 2:218927368-218927390 CCCTGAATTGCAGAGCAGCCAGG No data
Right 946317542 2:218927391-218927413 CATTCACATGATGCAGCCGTGGG No data
946317536_946317542 5 Left 946317536 2:218927363-218927385 CCAAGCCCTGAATTGCAGAGCAG No data
Right 946317542 2:218927391-218927413 CATTCACATGATGCAGCCGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946317542 Original CRISPR CATTCACATGATGCAGCCGT GGG Intergenic
No off target data available for this crispr