ID: 946317543

View in Genome Browser
Species Human (GRCh38)
Location 2:218927392-218927414
Sequence ATTCACATGATGCAGCCGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946317539_946317543 0 Left 946317539 2:218927369-218927391 CCTGAATTGCAGAGCAGCCAGGC No data
Right 946317543 2:218927392-218927414 ATTCACATGATGCAGCCGTGGGG No data
946317536_946317543 6 Left 946317536 2:218927363-218927385 CCAAGCCCTGAATTGCAGAGCAG No data
Right 946317543 2:218927392-218927414 ATTCACATGATGCAGCCGTGGGG No data
946317534_946317543 19 Left 946317534 2:218927350-218927372 CCCTCTAGAAATTCCAAGCCCTG No data
Right 946317543 2:218927392-218927414 ATTCACATGATGCAGCCGTGGGG No data
946317535_946317543 18 Left 946317535 2:218927351-218927373 CCTCTAGAAATTCCAAGCCCTGA No data
Right 946317543 2:218927392-218927414 ATTCACATGATGCAGCCGTGGGG No data
946317537_946317543 1 Left 946317537 2:218927368-218927390 CCCTGAATTGCAGAGCAGCCAGG No data
Right 946317543 2:218927392-218927414 ATTCACATGATGCAGCCGTGGGG No data
946317533_946317543 20 Left 946317533 2:218927349-218927371 CCCCTCTAGAAATTCCAAGCCCT No data
Right 946317543 2:218927392-218927414 ATTCACATGATGCAGCCGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946317543 Original CRISPR ATTCACATGATGCAGCCGTG GGG Intergenic
No off target data available for this crispr