ID: 946318443

View in Genome Browser
Species Human (GRCh38)
Location 2:218932867-218932889
Sequence TCCCTGCTGATTGGAGGGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946318443_946318455 23 Left 946318443 2:218932867-218932889 CCAGACCCTCCAATCAGCAGGGA No data
Right 946318455 2:218932913-218932935 CCCCAGAAGAGGTCTGCCTGTGG No data
946318443_946318457 24 Left 946318443 2:218932867-218932889 CCAGACCCTCCAATCAGCAGGGA No data
Right 946318457 2:218932914-218932936 CCCAGAAGAGGTCTGCCTGTGGG No data
946318443_946318450 12 Left 946318443 2:218932867-218932889 CCAGACCCTCCAATCAGCAGGGA No data
Right 946318450 2:218932902-218932924 TGCCAACAGCCCCCCAGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946318443 Original CRISPR TCCCTGCTGATTGGAGGGTC TGG (reversed) Intergenic
No off target data available for this crispr