ID: 946318450

View in Genome Browser
Species Human (GRCh38)
Location 2:218932902-218932924
Sequence TGCCAACAGCCCCCCAGAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946318445_946318450 6 Left 946318445 2:218932873-218932895 CCTCCAATCAGCAGGGAACTGAG No data
Right 946318450 2:218932902-218932924 TGCCAACAGCCCCCCAGAAGAGG No data
946318441_946318450 13 Left 946318441 2:218932866-218932888 CCCAGACCCTCCAATCAGCAGGG No data
Right 946318450 2:218932902-218932924 TGCCAACAGCCCCCCAGAAGAGG No data
946318447_946318450 3 Left 946318447 2:218932876-218932898 CCAATCAGCAGGGAACTGAGGCC No data
Right 946318450 2:218932902-218932924 TGCCAACAGCCCCCCAGAAGAGG No data
946318443_946318450 12 Left 946318443 2:218932867-218932889 CCAGACCCTCCAATCAGCAGGGA No data
Right 946318450 2:218932902-218932924 TGCCAACAGCCCCCCAGAAGAGG No data
946318439_946318450 14 Left 946318439 2:218932865-218932887 CCCCAGACCCTCCAATCAGCAGG No data
Right 946318450 2:218932902-218932924 TGCCAACAGCCCCCCAGAAGAGG No data
946318444_946318450 7 Left 946318444 2:218932872-218932894 CCCTCCAATCAGCAGGGAACTGA No data
Right 946318450 2:218932902-218932924 TGCCAACAGCCCCCCAGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946318450 Original CRISPR TGCCAACAGCCCCCCAGAAG AGG Intergenic
No off target data available for this crispr