ID: 946318457

View in Genome Browser
Species Human (GRCh38)
Location 2:218932914-218932936
Sequence CCCAGAAGAGGTCTGCCTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946318448_946318457 -6 Left 946318448 2:218932897-218932919 CCTCCTGCCAACAGCCCCCCAGA No data
Right 946318457 2:218932914-218932936 CCCAGAAGAGGTCTGCCTGTGGG No data
946318444_946318457 19 Left 946318444 2:218932872-218932894 CCCTCCAATCAGCAGGGAACTGA No data
Right 946318457 2:218932914-218932936 CCCAGAAGAGGTCTGCCTGTGGG No data
946318443_946318457 24 Left 946318443 2:218932867-218932889 CCAGACCCTCCAATCAGCAGGGA No data
Right 946318457 2:218932914-218932936 CCCAGAAGAGGTCTGCCTGTGGG No data
946318447_946318457 15 Left 946318447 2:218932876-218932898 CCAATCAGCAGGGAACTGAGGCC No data
Right 946318457 2:218932914-218932936 CCCAGAAGAGGTCTGCCTGTGGG No data
946318445_946318457 18 Left 946318445 2:218932873-218932895 CCTCCAATCAGCAGGGAACTGAG No data
Right 946318457 2:218932914-218932936 CCCAGAAGAGGTCTGCCTGTGGG No data
946318441_946318457 25 Left 946318441 2:218932866-218932888 CCCAGACCCTCCAATCAGCAGGG No data
Right 946318457 2:218932914-218932936 CCCAGAAGAGGTCTGCCTGTGGG No data
946318439_946318457 26 Left 946318439 2:218932865-218932887 CCCCAGACCCTCCAATCAGCAGG No data
Right 946318457 2:218932914-218932936 CCCAGAAGAGGTCTGCCTGTGGG No data
946318449_946318457 -9 Left 946318449 2:218932900-218932922 CCTGCCAACAGCCCCCCAGAAGA No data
Right 946318457 2:218932914-218932936 CCCAGAAGAGGTCTGCCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946318457 Original CRISPR CCCAGAAGAGGTCTGCCTGT GGG Intergenic
No off target data available for this crispr