ID: 946320044

View in Genome Browser
Species Human (GRCh38)
Location 2:218947807-218947829
Sequence GTTCACTGCCTGGCATGTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946320042_946320044 10 Left 946320042 2:218947774-218947796 CCGACTCTACAGGGCAGGGACTT No data
Right 946320044 2:218947807-218947829 GTTCACTGCCTGGCATGTAGAGG No data
946320039_946320044 15 Left 946320039 2:218947769-218947791 CCTTTCCGACTCTACAGGGCAGG No data
Right 946320044 2:218947807-218947829 GTTCACTGCCTGGCATGTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946320044 Original CRISPR GTTCACTGCCTGGCATGTAG AGG Intergenic
No off target data available for this crispr