ID: 946320879

View in Genome Browser
Species Human (GRCh38)
Location 2:218953774-218953796
Sequence CAGCTCAGACAGCTTGGTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 271
Summary {0: 1, 1: 7, 2: 15, 3: 33, 4: 215}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946320875_946320879 -5 Left 946320875 2:218953756-218953778 CCGCTGCATGGCGGCCTCCAGCT 0: 1
1: 12
2: 14
3: 24
4: 246
Right 946320879 2:218953774-218953796 CAGCTCAGACAGCTTGGTGTTGG 0: 1
1: 7
2: 15
3: 33
4: 215
946320868_946320879 22 Left 946320868 2:218953729-218953751 CCAGCTGCGTGCCATGTCCTGCT 0: 1
1: 0
2: 1
3: 31
4: 243
Right 946320879 2:218953774-218953796 CAGCTCAGACAGCTTGGTGTTGG 0: 1
1: 7
2: 15
3: 33
4: 215
946320872_946320879 5 Left 946320872 2:218953746-218953768 CCTGCTTGGCCCGCTGCATGGCG 0: 1
1: 8
2: 12
3: 17
4: 105
Right 946320879 2:218953774-218953796 CAGCTCAGACAGCTTGGTGTTGG 0: 1
1: 7
2: 15
3: 33
4: 215
946320874_946320879 -4 Left 946320874 2:218953755-218953777 CCCGCTGCATGGCGGCCTCCAGC 0: 1
1: 12
2: 17
3: 51
4: 252
Right 946320879 2:218953774-218953796 CAGCTCAGACAGCTTGGTGTTGG 0: 1
1: 7
2: 15
3: 33
4: 215
946320867_946320879 23 Left 946320867 2:218953728-218953750 CCCAGCTGCGTGCCATGTCCTGC 0: 1
1: 0
2: 2
3: 18
4: 244
Right 946320879 2:218953774-218953796 CAGCTCAGACAGCTTGGTGTTGG 0: 1
1: 7
2: 15
3: 33
4: 215
946320870_946320879 11 Left 946320870 2:218953740-218953762 CCATGTCCTGCTTGGCCCGCTGC 0: 13
1: 9
2: 21
3: 34
4: 222
Right 946320879 2:218953774-218953796 CAGCTCAGACAGCTTGGTGTTGG 0: 1
1: 7
2: 15
3: 33
4: 215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946320879 Original CRISPR CAGCTCAGACAGCTTGGTGT TGG Intergenic
901040211 1:6358971-6358993 CAGCTCAGGAAGCTGGGGGTGGG - Intronic
902115720 1:14119374-14119396 CTGCTCAGACAGTTCGCTGTTGG + Intergenic
902323853 1:15685222-15685244 CACCACAGACACCTTGCTGTGGG + Intronic
903364897 1:22800078-22800100 CAGCTCTGACAGCAGGGTGTGGG - Intronic
903725152 1:25436754-25436776 CAGCTGAGACAATTTGATGTCGG - Intronic
903751504 1:25624249-25624271 TAGCTCAGACAGCAGGGTTTTGG + Intronic
903777694 1:25803650-25803672 CAGATCATACAGCTAGGTGGTGG + Intronic
906223701 1:44103709-44103731 CAGCTCGGACAGCTTGGCGTTGG + Intergenic
907312443 1:53546678-53546700 CAGCAGAGGCACCTTGGTGTCGG - Intronic
907469685 1:54665254-54665276 CAGCACAGTCAGCTAGGGGTTGG - Intronic
909232283 1:73105878-73105900 CAGCTCGGACAGCTTGGTGTTGG - Intergenic
911658655 1:100475376-100475398 CATCTCTGTCATCTTGGTGTTGG + Intronic
912328476 1:108793295-108793317 CAGCTGAGACAGCTGAGTGAAGG - Intronic
912746354 1:112248638-112248660 CAGCTCAGACAGTTCGGCCTGGG + Intergenic
914932817 1:151949895-151949917 CAGCTCTGCCAGCGTGGCGTTGG + Intergenic
915520267 1:156437707-156437729 AAGGCCAGACAGCTTGGTGGAGG + Intergenic
915619812 1:157074298-157074320 CAGCTCGGACAACTTGGCGTTGG - Intergenic
920787007 1:209051321-209051343 GAGCCCAGAGGGCTTGGTGTGGG + Intergenic
922597267 1:226823696-226823718 CAGGTGAGACGGCTTGGAGTAGG - Intergenic
922680419 1:227590702-227590724 CTGATCAGGCAGCTTAGTGTAGG + Intronic
923066006 1:230517987-230518009 CAGCTCAGCCAGCTTAGTCCAGG - Intergenic
924698057 1:246420336-246420358 CTGCTCCTACAGCTTGGGGTTGG + Intronic
1063714539 10:8514070-8514092 CAGCTCAGACACCTTGGTGTTGG + Intergenic
1064016124 10:11773693-11773715 CAGCTCACACAGGTAGTTGTCGG - Intergenic
1065637689 10:27746784-27746806 GAGCGCAGGCAGCTTCGTGTTGG - Intergenic
1065656761 10:27959332-27959354 CACCTCAGAGAGAGTGGTGTTGG + Intronic
1068044707 10:51871541-51871563 CAGCACTGACAGCTTGGGGCTGG - Intronic
1069320012 10:67158096-67158118 CTGGTCAGGCAGCTTAGTGTAGG - Intronic
1071235980 10:83648927-83648949 CAGGACAGACAGGATGGTGTTGG + Intergenic
1072416705 10:95252569-95252591 CATCTCTGTCATCTTGGTGTTGG - Intronic
1072717647 10:97762304-97762326 CAGCTCCCACAGCCTGGCGTGGG + Intergenic
1074352929 10:112755824-112755846 CAGCTAAGACAGGTTGGCCTAGG + Intronic
1076033506 10:127178874-127178896 CACACAAGACAGCTTGGTGTGGG + Intronic
1076593428 10:131608374-131608396 CAGCTCAGTCAGGTAGGTTTCGG - Intergenic
1076923986 10:133472125-133472147 CAGCTCACACAGGCTGGTGATGG - Intergenic
1077341818 11:2029612-2029634 CAGCTCTGCCTGCTTGGAGTTGG + Intergenic
1077730330 11:4723118-4723140 CAGCTCGGACAGCTTGGAGTTGG + Intronic
1081965724 11:47168221-47168243 CATCTCAGACAGCACGGAGTGGG + Exonic
1084449360 11:69226450-69226472 CATCTCTGTCATCTTGGTGTTGG + Intergenic
1086033850 11:82393077-82393099 CAGCTAAGACAGCTTCCTTTTGG - Intergenic
1088428457 11:109730780-109730802 CAGTTAAGACACATTGGTGTAGG + Intergenic
1088640399 11:111867366-111867388 CACCTCTGTCATCTTGGTGTTGG - Intronic
1088699165 11:112396719-112396741 CAGCTCAGACTGCTCTGTGGTGG + Intergenic
1089599225 11:119603238-119603260 CAGCTCCGACAGCTCGGCGTTGG + Intergenic
1089682486 11:120126680-120126702 AAGCTAAGACAGCTTTGTGGAGG - Intronic
1090156503 11:124443686-124443708 CAACACAGAGAGCTTGGTGATGG - Intergenic
1202824804 11_KI270721v1_random:84801-84823 CAGCTCTGCCTGCTTGGAGTTGG + Intergenic
1091822077 12:3483034-3483056 CAGGTCACACAGCAAGGTGTGGG - Intronic
1093102005 12:15038660-15038682 GAGCTCAGAGGGTTTGGTGTGGG - Intergenic
1093567906 12:20630199-20630221 CAGCCCACGCAGCTTGGGGTAGG + Intronic
1096518728 12:52172332-52172354 CAGCTGGGCCAGCTTGGTCTTGG + Exonic
1096547411 12:52350177-52350199 CAGCTCAGCCAGCTTGCAGTGGG - Intergenic
1096549400 12:52362385-52362407 CAGCTCAGCCAGCTTGCAGCGGG + Exonic
1096578273 12:52568303-52568325 CAGCTCATCCAGCTTGGCCTGGG + Exonic
1096626435 12:52898813-52898835 CAGCTCGGACAACTTGGCGTTGG + Exonic
1097615571 12:61880368-61880390 CAGCTCCAACAGCTTGGTGTTGG - Intronic
1098264703 12:68706675-68706697 CAGCTTGGACAGCTTGGTGTTGG - Intronic
1100689919 12:97028837-97028859 CAGATCAGAGAGAATGGTGTAGG + Intergenic
1101233276 12:102763723-102763745 AGGCTCAGACAGCTTGGAGTGGG + Intergenic
1101522309 12:105495324-105495346 TAGCTCAAACAGCTGGGTGTTGG + Intergenic
1102663367 12:114548846-114548868 CTTCTCTGACAGCATGGTGTGGG - Intergenic
1103464074 12:121128123-121128145 CAGCTTAGTCTCCTTGGTGTTGG + Intergenic
1104225410 12:126827916-126827938 CAGCTCATTCGGCTTGCTGTGGG - Intergenic
1104628079 12:130376181-130376203 CTGCTCAGACTTCTTGGTCTCGG + Intergenic
1105281187 13:18963622-18963644 CAGCTCAGAGAGCCTTGTGTGGG - Intergenic
1105290389 13:19049638-19049660 CAGCTCAGAGAGCCTTGTGTGGG - Intergenic
1112051703 13:95649497-95649519 CAGCTGTCACAGGTTGGTGTTGG + Intergenic
1112335228 13:98509706-98509728 GAGCTCAGTCTGCTGGGTGTAGG - Intronic
1113639993 13:111950319-111950341 CAGGTCTGACACCTTGGTGGAGG + Intergenic
1113886354 13:113660733-113660755 CATCTCTGTCACCTTGGTGTTGG - Intergenic
1115951625 14:38728077-38728099 CAGCTCGGACAGCTTGGTGTTGG - Intergenic
1116326902 14:43541259-43541281 CAGCTCGGACAGCTTGGCCTTGG + Intergenic
1119043983 14:71301288-71301310 CAGATCAGACTTCTTGGTTTTGG - Intergenic
1120549027 14:85846531-85846553 CAGGTGAGAGAGCTTGGTATGGG - Intergenic
1120817082 14:88872403-88872425 CAGCACAGCCAGGTTGTTGTAGG - Exonic
1123457134 15:20436436-20436458 CAGCACAGAGAGCATGGGGTGGG + Intergenic
1123660928 15:22563923-22563945 CAGCACAGAGAGCATGGGGTGGG - Intergenic
1124263288 15:28211589-28211611 CAGCACAGAGAGCATGGGGTGGG + Intronic
1124314729 15:28658157-28658179 CAGCACAGAGAGCATGGGGTGGG - Intergenic
1125841030 15:42801347-42801369 CAGCTCAGACAGCTTGGCATTGG + Intronic
1126467319 15:48972950-48972972 CAGCTCGGACAGCTTAGTCTTGG - Intergenic
1126795188 15:52254558-52254580 CAGCACAGAAAGCTTTGGGTAGG - Intronic
1127670265 15:61188116-61188138 AAGCCCAGACAGCTTGGGGTTGG - Intronic
1128526910 15:68418774-68418796 GAGCTCAGACAGTTTGGTTTTGG + Intronic
1128842243 15:70859758-70859780 CAGCTCGGACAGCTTGGCGTTGG - Intronic
1129597927 15:76979384-76979406 CAGCTCGGACAACTTGGCATTGG + Intergenic
1129672732 15:77616160-77616182 CACCTCAGACAGCCTGGCATTGG + Intronic
1130582726 15:85153022-85153044 CAACTCACACTTCTTGGTGTGGG - Intergenic
1131879896 15:96851491-96851513 CAAATCAGACAGCCTGCTGTGGG - Intergenic
1137233054 16:46586137-46586159 CATCTCTGACATCTTGGTTTTGG - Intronic
1138503604 16:57464526-57464548 CAGCTCAGAGAGTTTGGATTAGG + Intronic
1139099059 16:63743876-63743898 GAGCCCAGAGAGTTTGGTGTAGG + Intergenic
1139483254 16:67242388-67242410 CAGGACAGACAGCTGGGGGTGGG - Intronic
1140753718 16:78048831-78048853 CAGCTTGGACAGCTTGGCGTTGG + Intronic
1141102779 16:81210219-81210241 CAGCCCTGACACCTTGGTGTCGG - Intergenic
1141461931 16:84182949-84182971 CAGCTCAGACTGCATGGAGCAGG + Intronic
1141850287 16:86640458-86640480 CAGCCCAGACAGCAGGGGGTTGG + Intergenic
1141890972 16:86926313-86926335 CGGGTCAGACAGCTCGGTGAGGG - Intergenic
1141917378 16:87108752-87108774 CAGCCCAGCCAGCTTGCTGCAGG + Intronic
1142807215 17:2377636-2377658 CAGCTCAGAGAGATGGGTGATGG + Intronic
1142898460 17:2997215-2997237 CTGCTCACCCAGCTTGGCGTAGG - Intronic
1143498751 17:7326981-7327003 CACCTCAGACAGCTCCATGTTGG + Exonic
1144090731 17:11853998-11854020 CAGCTCTGTCAGGTTGGTCTGGG - Exonic
1144585182 17:16483351-16483373 CAGCACAGACAGGTTGGCCTCGG + Intronic
1148840752 17:50495343-50495365 CTGCACAGAGAGCCTGGTGTAGG - Intergenic
1150516378 17:65814291-65814313 CAGAGCAGACAGCTTGGTTTTGG - Intronic
1152626272 17:81389224-81389246 CAGATCAGACAGATGGGGGTTGG - Intergenic
1155124357 18:22856925-22856947 TAGCTCAGAATGTTTGGTGTAGG - Intronic
1157063555 18:44321169-44321191 CAGCTCGGACAGCTTGGTGTTGG + Intergenic
1157580939 18:48773794-48773816 CAGCTCAGGCAGGTTGGTATGGG - Intronic
1159000826 18:62973639-62973661 CCTCTCAGAGAGCTTGGTGGAGG + Intronic
1160240057 18:77116935-77116957 CAGCTCCGACCTGTTGGTGTTGG - Intronic
1160359837 18:78265005-78265027 CAGGTAAGGCAGCTTGGTATTGG - Intergenic
1160532852 18:79575704-79575726 CATCTCAGGCACCTTGGTGATGG + Intergenic
1160743162 19:696892-696914 CAGCTCACACAGCCGGGTGATGG + Intergenic
1162617762 19:11815515-11815537 CATCTCTGACAGGTTCGTGTGGG + Intronic
1163725826 19:18922523-18922545 CAGCCCAGACAGCGTGGGGAGGG + Intronic
1164435231 19:28222995-28223017 CAGCTCAAACAGCTCTGTGCTGG + Intergenic
1164489176 19:28690961-28690983 CATCTCTGACATCTTGGTTTTGG - Intergenic
1166745151 19:45138379-45138401 GAGCTCAGGCAGCCTGTTGTTGG + Intronic
926332021 2:11833393-11833415 AAGCACAGAGAGCTTGGTATGGG - Intergenic
927948253 2:27150223-27150245 CAACTTGGAGAGCTTGGTGTCGG - Exonic
928395727 2:30942097-30942119 ACTCTCTGACAGCTTGGTGTTGG + Intronic
931696314 2:64873344-64873366 CTGCTCAGACTTCTTGGTCTCGG - Intergenic
931920452 2:67009574-67009596 CATCTCATACAGGTTGGTGGGGG - Intergenic
932224968 2:70032323-70032345 CTGCTCAGACACCTTGGCTTAGG + Intergenic
934911137 2:98255394-98255416 CAGCTCAGAAAGCCTGCTTTTGG + Intronic
936049936 2:109214972-109214994 GAGCTCACACATCTTGGTGGAGG + Intronic
936156229 2:110049030-110049052 CAAGTCAGGAAGCTTGGTGTGGG + Intergenic
936188459 2:110322398-110322420 CAAGTCAGGAAGCTTGGTGTGGG - Intergenic
941747354 2:169101141-169101163 AAGCCCAGGCAGCTTGATGTTGG + Intergenic
942558646 2:177198147-177198169 CAGCTCGGACAGCTTGGCGTTGG - Intergenic
942759520 2:179382395-179382417 CAGATCAGCCAACTGGGTGTTGG - Intergenic
943064431 2:183071424-183071446 CAGCTCAGACAGCTTGGCGCTGG + Intergenic
943830318 2:192452686-192452708 GAGCCCAGACAGTTTTGTGTGGG + Intergenic
944420739 2:199527271-199527293 CAGCTCAGACAGGTCGATGTTGG - Intergenic
944580414 2:201127304-201127326 CAGCTCAGGCAGGGTGGAGTTGG + Intronic
944763445 2:202840715-202840737 CAGCTCGGAGAGCTTGGCATTGG + Intronic
946320879 2:218953774-218953796 CAGCTCAGACAGCTTGGTGTTGG + Intergenic
1168892678 20:1305210-1305232 CGGGTCACTCAGCTTGGTGTAGG - Exonic
1170207780 20:13817924-13817946 AAGCTCAGACAGCTTAGGATAGG + Exonic
1170529986 20:17281524-17281546 CAGTTCAGGCTGCTTGGTCTGGG + Intronic
1171176180 20:23051885-23051907 GAACTCAGCCAGCCTGGTGTGGG - Intergenic
1173383659 20:42568690-42568712 CAGCTCAGACAGCTCTCTGTAGG - Intronic
1174601914 20:51731837-51731859 CAGCTGTGACAGCATGGGGTGGG - Intronic
1179710414 21:43210009-43210031 CAGCCCAGACAGCCGGGTGCTGG - Intergenic
1180571418 22:16724887-16724909 GACCTCAGACAGGTTAGTGTGGG - Intergenic
1181167565 22:20991814-20991836 CAGCTCCGACAGCGAGGTGAGGG + Exonic
1182619616 22:31611704-31611726 CAGCCTAGACAGCCTGGGGTGGG - Intronic
1185166899 22:49266929-49266951 CAGCTCAGACACCCGGGTGCAGG + Intergenic
1185288816 22:50014117-50014139 CAGCTCAGCCAGCCTGGGATAGG - Intergenic
949716366 3:6936143-6936165 GAGCTGAGACAGCTGGGTGCTGG - Intronic
949763114 3:7495266-7495288 CAGGTCAGCCTGCTTGGTGGAGG + Intronic
950005578 3:9689067-9689089 CAACTCAGGCAGCTTGGTAAGGG + Exonic
951690405 3:25389595-25389617 CAGCGCAGAGAACTGGGTGTTGG + Intronic
952611544 3:35216086-35216108 CAGCTCGGACAGCTTGGCGTTGG + Intergenic
952808603 3:37381235-37381257 CATCTCTGTCATCTTGGTGTTGG + Intergenic
953896897 3:46809950-46809972 CAGCTGACACAGCCTGGAGTGGG - Intronic
955839480 3:63096756-63096778 CAGCTCGGACAGCTTGGCGTTGG + Intergenic
956124050 3:65994690-65994712 TGGCTCAGACAGCTGGGTGCTGG + Intronic
957966175 3:87324309-87324331 CAGCTCATACAGCTTGGTGTTGG - Intergenic
961983981 3:131113055-131113077 CACCTCTGCCAGCTTGGTTTAGG - Intronic
962205058 3:133427573-133427595 CTCCTCAGCCAGCTTGGGGTTGG + Intronic
962712816 3:138101865-138101887 CAGCTCGGACAGCTTGGCGTTGG + Intronic
963828699 3:149983874-149983896 CAGCTCTGACACCTTGATTTTGG - Intronic
965179830 3:165388264-165388286 TAGCCCACACAGCCTGGTGTTGG - Intergenic
965442230 3:168729290-168729312 CAGATCAGCCAGCTAGGTGCTGG - Intergenic
965605779 3:170496477-170496499 CAGCTCCGACCGCTTGGCGCTGG - Intronic
966529743 3:180962925-180962947 CAGCTGCGACAGATTGGTATGGG + Exonic
967606478 3:191452560-191452582 CAGATCAGCCACCTGGGTGTTGG + Intergenic
967895973 3:194396764-194396786 CAGCTCAGAACCCTGGGTGTGGG - Exonic
968359368 3:198136720-198136742 CAGCACAGACACCTCGGTGTAGG - Intergenic
968626985 4:1630172-1630194 CAGCTCCGACAGCTTGGAAGGGG - Intronic
971173824 4:24261910-24261932 TAGCACACACAGCTTGGTGGAGG - Intergenic
972197340 4:36670064-36670086 TAGCTCAGACAGCTGGGAGGTGG + Intergenic
973042297 4:45485381-45485403 GAGCCCAGACAGATTGTTGTTGG - Intergenic
973106636 4:46346890-46346912 CAGCTCTGACAGCTTTTTGATGG - Intronic
973656133 4:53049719-53049741 CAGATTAGGCAGCTTGGTGCAGG - Intronic
974061546 4:57040391-57040413 CATCACAAACAGCTTGGTGGGGG + Intronic
977928671 4:102729106-102729128 CAGCTTGGACAGCTTGGCGTTGG + Intronic
977978264 4:103292904-103292926 CAGCTCAGTAAAATTGGTGTTGG - Intergenic
978857960 4:113414577-113414599 ATTCTCAGGCAGCTTGGTGTGGG + Intergenic
979052778 4:115955225-115955247 CTGGTCAGGCAGCTTTGTGTAGG - Intergenic
979156694 4:117401383-117401405 AAGCCCAGACGGTTTGGTGTGGG + Intergenic
985087965 4:186333774-186333796 CATCTCTGTCACCTTGGTGTTGG + Intergenic
985695266 5:1336573-1336595 CAGCTCACACAGCTCTGTATGGG + Intronic
986366196 5:7034605-7034627 GAAATCAGACAGCTTAGTGTTGG + Intergenic
986548754 5:8929028-8929050 CAGCTCAGACAGCTGCATGTAGG + Intergenic
988870554 5:35384879-35384901 CAGCTCAGAAGCCATGGTGTGGG - Intergenic
989698688 5:44236125-44236147 CAGAGCAGACGGCCTGGTGTGGG + Intergenic
990724923 5:58742824-58742846 CAGATAAGACAGCTTCTTGTAGG + Intronic
990900488 5:60743939-60743961 CAGCTCAGACAGCTTGGCGTTGG + Intergenic
991306742 5:65184976-65184998 GAGCTCAGACAGCTGAGAGTTGG + Intronic
994320802 5:98392461-98392483 CAGCTCGGACAGCTTGCGGTTGG + Intergenic
995458317 5:112375512-112375534 CATCTCTGCCATCTTGGTGTTGG - Intronic
995805328 5:116045971-116045993 CAGCTGAAACAGCTTGGAGAGGG + Intronic
996379639 5:122849919-122849941 CAGCTCAGAGAGTTAGGTGGAGG + Intronic
996511789 5:124324750-124324772 CACCACAGACAGCTTGCTTTTGG - Intergenic
997021467 5:130007675-130007697 AAGCCCAGAGAGTTTGGTGTGGG + Intronic
997472541 5:134124851-134124873 CAGCTCAGACATGGTGGAGTGGG - Intronic
998249179 5:140538559-140538581 CTGCTCTGACAGCTTTATGTCGG + Intronic
998821330 5:146060285-146060307 CAGCTCAGAGATTTTAGTGTTGG + Intronic
998887174 5:146706559-146706581 CAGCTCGGACAGCTTAGCGTTGG + Intronic
999204442 5:149837934-149837956 CAGATCAGACACCCGGGTGTGGG - Intronic
1000569579 5:162895516-162895538 AAGCCCAGAAAGTTTGGTGTGGG + Intergenic
1001936274 5:175708092-175708114 CAGAACACACAGCTGGGTGTGGG + Intergenic
1002263020 5:178007501-178007523 CAGCACAGGCAGCGGGGTGTGGG + Intronic
1002369744 5:178742175-178742197 CAGCCCCCACAGCCTGGTGTTGG - Intergenic
1002939092 6:1700077-1700099 GAGCTCATACACTTTGGTGTCGG - Intronic
1005315506 6:24599398-24599420 CAGCTTGGACAGCTTGGCATTGG - Intronic
1010515559 6:76769314-76769336 CAGCTCACACATCTGGGTGGGGG - Intergenic
1011810541 6:91127860-91127882 GAGTTCAGACACCTTGGTTTTGG - Intergenic
1012253720 6:97008521-97008543 CAGCTCAGAGAGTTTGGCATGGG - Intronic
1012661850 6:101908094-101908116 CAGCTCGGACAGAATGATGTAGG - Intronic
1013916683 6:115347691-115347713 CAGCACAGGCTGCTTGCTGTGGG - Intergenic
1015496621 6:133889729-133889751 CAGCTTGGAGAGCTTGGTGTCGG - Exonic
1015539190 6:134297356-134297378 CAGCTCAGACAGCTTGGCGTTGG + Intronic
1015794546 6:136997942-136997964 CAGTTCATAAACCTTGGTGTAGG - Intergenic
1016785297 6:148004859-148004881 TGGCTTAGACAGCTTGGAGTAGG - Intergenic
1018235192 6:161717036-161717058 GACCTCTGACAGCTGGGTGTTGG - Intronic
1018317263 6:162569322-162569344 CAGCTTGGACAGCTTGGTGTTGG - Intronic
1019260627 7:79956-79978 CAGCACAGACACCTCGGTGTAGG + Intergenic
1022189116 7:27999798-27999820 CAGCTCAGACAGCTCTGCCTTGG + Intronic
1023223718 7:37947766-37947788 AAGCTGAGACATCTTGGTGTTGG - Intronic
1023289658 7:38656239-38656261 CAGCTCAGACAGCTTGGCTTTGG - Intergenic
1028666970 7:93356694-93356716 CAACTCAGTGAGCTTGGTATGGG + Intronic
1029282219 7:99443129-99443151 CTGCTCAGGCAGCTAGGTTTGGG - Intronic
1029453957 7:100657902-100657924 CAGCTCTGACAACTTGGGGTAGG + Intergenic
1029789438 7:102827193-102827215 CAGCTCAGCTAGCTTGCTGGAGG + Intronic
1029994319 7:104991955-104991977 CACCTCAAACATCTTTGTGTTGG - Intergenic
1030267530 7:107635571-107635593 CAGCTCAGACAACTTTGGGTGGG + Intergenic
1030688460 7:112509418-112509440 AACCTCAGACAGCATGGTTTTGG - Intergenic
1030866156 7:114704068-114704090 CAGCACAGACAGCTATGAGTGGG - Intergenic
1034490647 7:151391502-151391524 CAGCTCACCCAGCTGCGTGTGGG - Intronic
1035259455 7:157652448-157652470 CAGCTCTGACACCTTGCTGATGG + Intronic
1038878216 8:31576030-31576052 CAGCTCCTACAACTTTGTGTGGG - Intergenic
1041013325 8:53566411-53566433 CAGCTCAGACAGTTAGGGTTAGG + Intergenic
1041781144 8:61579265-61579287 CAGCTCGGACAACTTGGCGTTGG - Intronic
1042003347 8:64152198-64152220 AAGCTCAGACATCTTTCTGTGGG + Intergenic
1042039320 8:64576212-64576234 CAGCTGAGGGAGCTAGGTGTGGG - Intergenic
1042271541 8:66961502-66961524 CAGCTTGGACAGCTTGGTGTCGG + Exonic
1042722867 8:71843741-71843763 CAGCTTGGAGAGCTTAGTGTCGG + Exonic
1043344141 8:79279423-79279445 CAGTTCAGATAGCTTTGTCTTGG + Intergenic
1043422055 8:80107870-80107892 CTGGTTAGACAGATTGGTGTTGG + Intronic
1045466129 8:102471276-102471298 CATCTCTGTCATCTTGGTGTTGG - Intergenic
1047228158 8:122973907-122973929 CAGTTCAGAAAGCCTTGTGTGGG - Exonic
1048836655 8:138525096-138525118 AAGATCAGACAGCTTGGAGATGG - Intergenic
1050243889 9:3667793-3667815 CAGCACAGGCATCTGGGTGTAGG - Intergenic
1050928609 9:11297309-11297331 AAGCCCAGAGAGTTTGGTGTAGG - Intergenic
1051449668 9:17181507-17181529 CATCTCTGTCATCTTGGTGTTGG + Intronic
1053409202 9:37904628-37904650 AAGCTCAGACAGCTTGCGGGGGG + Intronic
1056711281 9:88993906-88993928 CAGCTCACACAGCGAGGTGACGG + Exonic
1057943653 9:99306205-99306227 CAGCTCGGACAGCTTGGCGTTGG - Intergenic
1058372055 9:104280843-104280865 CATCTCAGCCAGCTGGGAGTAGG + Intergenic
1058539417 9:105996013-105996035 CATCTCAGGCAGCATGGTGAGGG - Intergenic
1058643266 9:107107502-107107524 CAGCTCACAGAGTGTGGTGTTGG - Intergenic
1058902761 9:109456546-109456568 CAGATCAGCCAGGTTGGTCTGGG + Intronic
1059226923 9:112680983-112681005 CAGCAGAGGCAGCATGGTGTGGG + Intergenic
1062744055 9:138200434-138200456 CAGCACAGACACCTCGGTGTAGG - Intergenic
1186716182 X:12254406-12254428 CAGCTGAAACAGCTTGCTTTGGG + Intronic
1187173296 X:16871225-16871247 CAGCTCCGCCAGCTTGGGGTGGG - Intergenic
1189328976 X:40131131-40131153 CAGGTCAGACAACCTGGTTTGGG - Intronic
1189893782 X:45632671-45632693 CAGCTCGGACAACTTGGCCTTGG + Intergenic
1190325686 X:49205618-49205640 CAGTGCCGACAGCTTGGTGGAGG - Exonic
1192676900 X:73206590-73206612 CAGCTGAGTCATCTTGGTGTTGG - Intergenic
1192846025 X:74907918-74907940 CAGCTGAGACAGCCTGAGGTGGG - Intronic
1196554366 X:117069966-117069988 GAGCTCAGAGGGTTTGGTGTGGG + Intergenic
1197657098 X:129128386-129128408 CAGCTGTGACAGGTTGGTGGCGG - Intergenic
1199406159 X:147463176-147463198 CAGCTCTGACAGCTGAGTGGAGG - Intergenic
1200141976 X:153906959-153906981 CAGCTCACTGAGCTGGGTGTAGG + Exonic
1200394931 X:155979444-155979466 CAGGGCAGGCAGCTTGGGGTGGG - Intergenic