ID: 946321362

View in Genome Browser
Species Human (GRCh38)
Location 2:218956264-218956286
Sequence CAGATTAGGGAGAAGCAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946321357_946321362 25 Left 946321357 2:218956216-218956238 CCTCACATGGATGCTGTGCACAC No data
Right 946321362 2:218956264-218956286 CAGATTAGGGAGAAGCAGACAGG No data
946321358_946321362 -8 Left 946321358 2:218956249-218956271 CCCATCAGACAGAAACAGATTAG No data
Right 946321362 2:218956264-218956286 CAGATTAGGGAGAAGCAGACAGG No data
946321359_946321362 -9 Left 946321359 2:218956250-218956272 CCATCAGACAGAAACAGATTAGG No data
Right 946321362 2:218956264-218956286 CAGATTAGGGAGAAGCAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946321362 Original CRISPR CAGATTAGGGAGAAGCAGAC AGG Intergenic
No off target data available for this crispr