ID: 946322084

View in Genome Browser
Species Human (GRCh38)
Location 2:218960145-218960167
Sequence CGGGATCCCCCCGACGGCGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 59
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 53}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946322072_946322084 20 Left 946322072 2:218960102-218960124 CCTGGTCCAGCAACGCAACCGCG 0: 1
1: 0
2: 0
3: 3
4: 20
Right 946322084 2:218960145-218960167 CGGGATCCCCCCGACGGCGGCGG 0: 1
1: 0
2: 0
3: 5
4: 53
946322079_946322084 -7 Left 946322079 2:218960129-218960151 CCTTCTCCGCAAGGGCCGGGATC 0: 1
1: 0
2: 1
3: 5
4: 91
Right 946322084 2:218960145-218960167 CGGGATCCCCCCGACGGCGGCGG 0: 1
1: 0
2: 0
3: 5
4: 53
946322071_946322084 21 Left 946322071 2:218960101-218960123 CCCTGGTCCAGCAACGCAACCGC 0: 1
1: 0
2: 0
3: 3
4: 37
Right 946322084 2:218960145-218960167 CGGGATCCCCCCGACGGCGGCGG 0: 1
1: 0
2: 0
3: 5
4: 53
946322074_946322084 2 Left 946322074 2:218960120-218960142 CCGCGAGAACCTTCTCCGCAAGG 0: 1
1: 0
2: 0
3: 16
4: 383
Right 946322084 2:218960145-218960167 CGGGATCCCCCCGACGGCGGCGG 0: 1
1: 0
2: 0
3: 5
4: 53
946322068_946322084 27 Left 946322068 2:218960095-218960117 CCGACCCCCTGGTCCAGCAACGC 0: 1
1: 0
2: 2
3: 6
4: 128
Right 946322084 2:218960145-218960167 CGGGATCCCCCCGACGGCGGCGG 0: 1
1: 0
2: 0
3: 5
4: 53
946322066_946322084 29 Left 946322066 2:218960093-218960115 CCCCGACCCCCTGGTCCAGCAAC 0: 1
1: 0
2: 0
3: 9
4: 139
Right 946322084 2:218960145-218960167 CGGGATCCCCCCGACGGCGGCGG 0: 1
1: 0
2: 0
3: 5
4: 53
946322073_946322084 14 Left 946322073 2:218960108-218960130 CCAGCAACGCAACCGCGAGAACC 0: 1
1: 0
2: 0
3: 2
4: 16
Right 946322084 2:218960145-218960167 CGGGATCCCCCCGACGGCGGCGG 0: 1
1: 0
2: 0
3: 5
4: 53
946322070_946322084 22 Left 946322070 2:218960100-218960122 CCCCTGGTCCAGCAACGCAACCG 0: 1
1: 0
2: 0
3: 0
4: 37
Right 946322084 2:218960145-218960167 CGGGATCCCCCCGACGGCGGCGG 0: 1
1: 0
2: 0
3: 5
4: 53
946322069_946322084 23 Left 946322069 2:218960099-218960121 CCCCCTGGTCCAGCAACGCAACC 0: 1
1: 0
2: 0
3: 8
4: 82
Right 946322084 2:218960145-218960167 CGGGATCCCCCCGACGGCGGCGG 0: 1
1: 0
2: 0
3: 5
4: 53
946322067_946322084 28 Left 946322067 2:218960094-218960116 CCCGACCCCCTGGTCCAGCAACG 0: 1
1: 0
2: 0
3: 7
4: 102
Right 946322084 2:218960145-218960167 CGGGATCCCCCCGACGGCGGCGG 0: 1
1: 0
2: 0
3: 5
4: 53

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946322084 Original CRISPR CGGGATCCCCCCGACGGCGG CGG Exonic
901361365 1:8703429-8703451 CAGACTCCCCGCGACGGCGGCGG + Intronic
901934526 1:12618384-12618406 CGCGCTCCCCGCGACGGCGCAGG - Intergenic
905300778 1:36985071-36985093 CGGGATCATCCCTACGGTGGGGG + Intronic
908534636 1:65066702-65066724 CGGAGTCCCCGCGGCGGCGGCGG - Intergenic
1076895368 10:133308846-133308868 CGCGCAGCCCCCGACGGCGGCGG + Exonic
1081636756 11:44726967-44726989 CTGGAGCCCCGCGACGCCGGCGG - Intronic
1084265623 11:68003880-68003902 CAGGGTCCCCCCGGCGGGGGCGG - Intronic
1091897187 12:4115083-4115105 CAGGATCCCCCCGATAGCAGCGG - Intergenic
1111951273 13:94711381-94711403 CGTGTGCCCCCCGGCGGCGGCGG + Exonic
1122179916 14:99947366-99947388 CGGGCTTCCCCGGAGGGCGGTGG - Intergenic
1122418584 14:101561715-101561737 CGGGCTGCCCCCGGCGGCGGCGG - Exonic
1130295954 15:82647332-82647354 GGAGAGCCCCACGACGGCGGCGG - Intronic
1142560264 17:805327-805349 CGGGGTCCCCCCGACCGTGGTGG + Intronic
1142560570 17:806704-806726 CGGCATCCCCCCGACAGGGAAGG - Intronic
1156253931 18:35377281-35377303 CGGTTTCTCCCCGACGGCGTCGG - Exonic
1157849129 18:51030698-51030720 CGGGCTCCCGACGACGGCGGCGG + Intronic
1160450809 18:78965105-78965127 CTGGATCCCACCGACGGCTCCGG - Intergenic
1160450827 18:78965166-78965188 CTGGATCCCACCGACGGCTCCGG - Intergenic
1160690967 19:460616-460638 CCGGATCCACTCGGCGGCGGCGG + Exonic
1160719127 19:589885-589907 CGGGCTCCGGCCGGCGGCGGCGG + Exonic
1160778901 19:869135-869157 CGGGACCCCCCACACGGAGGAGG + Intronic
1162033199 19:7926041-7926063 CGGCCTCTCCCCGGCGGCGGCGG + Exonic
1162410687 19:10503266-10503288 CCGAGGCCCCCCGACGGCGGAGG - Exonic
1162471899 19:10877117-10877139 TGGGATCCCCCTGACAGCTGGGG + Intronic
1163606974 19:18280975-18280997 CGAGGGCCCCCCGGCGGCGGCGG + Exonic
1163607066 19:18281364-18281386 CGGGGCGCCCCCGACGGCCGCGG - Exonic
1163668283 19:18613167-18613189 CGGGATCTCTCCGAAGGAGGAGG + Intronic
1163804066 19:19385609-19385631 CGGGATCGCGCCGCCGGCCGGGG - Intergenic
926095717 2:10079906-10079928 CGCGCTCCCCGCGACCGCGGTGG + Exonic
931254114 2:60555294-60555316 TGCGATCTCCCCGGCGGCGGCGG - Intergenic
946322084 2:218960145-218960167 CGGGATCCCCCCGACGGCGGCGG + Exonic
1169191335 20:3660721-3660743 CGGGATCCGGGCGAGGGCGGGGG - Intronic
1176090585 20:63316625-63316647 CGGGGTCCCACCGAAGGCAGAGG - Exonic
1178314787 21:31558941-31558963 CGGGATCTCCGCGACGGGGCCGG + Exonic
1178440431 21:32593882-32593904 GGGGCTCTCCCCGGCGGCGGGGG - Intronic
1178708072 21:34890259-34890281 CGGAACGCCCCCGACGGCGCGGG + Intronic
953027362 3:39152957-39152979 CGGGCGCCCCCGGCCGGCGGGGG - Intronic
975342585 4:73258596-73258618 AGGGAGCCCCCCGGCGGTGGCGG - Exonic
978503500 4:109433669-109433691 CAGGATCCCCGCGCCCGCGGCGG + Intergenic
986293952 5:6422203-6422225 CGGGAGCCCCCAGACGCCAGAGG + Intergenic
990557749 5:56952200-56952222 CGGCACCCGCCCGGCGGCGGAGG + Intronic
992042377 5:72848556-72848578 CGGGAGCCCCCGGCCGCCGGGGG - Intronic
997191851 5:131945288-131945310 CAGGACCCCCCCGAAGCCGGTGG - Intronic
997505204 5:134411679-134411701 CGCGACCCGCCCGACGGCAGTGG - Exonic
997926173 5:138032965-138032987 CCGGATACCCCCGGCGGTGGTGG + Exonic
1004720432 6:18264170-18264192 CGGGAATCCCTGGACGGCGGCGG - Intronic
1007371266 6:41428156-41428178 CCGGAACGCCCCGAAGGCGGCGG - Intergenic
1007406089 6:41637213-41637235 CGGGATGGCCCCCACGGCGCCGG - Intronic
1017446349 6:154510341-154510363 CGGGATCCCGGCGGCGGCGGGGG - Exonic
1022363371 7:29685044-29685066 CGGGAACCTCCCCGCGGCGGCGG + Intergenic
1022427933 7:30285485-30285507 CGGGAACCTCCCCGCGGCGGCGG - Exonic
1022698011 7:32728695-32728717 CGGGAACCTCCCCGCGGCGGCGG - Intergenic
1029281557 7:99438942-99438964 CGGCATCCCTCGGGCGGCGGCGG + Intronic
1036723725 8:11201061-11201083 CTGGTCCCCCCCGTCGGCGGCGG + Exonic
1049585269 8:143430083-143430105 CGAGGTGCCCCCGACGGCGCCGG + Exonic
1062462002 9:136666048-136666070 CCGGCTCCCCCTGCCGGCGGCGG + Intronic
1189473577 X:41333035-41333057 CGGGGTCCCCGCAACGCCGGTGG + Intergenic
1197749273 X:129953490-129953512 CGGGAACCTTCCGACGGCGGGGG - Intergenic
1198683349 X:139204323-139204345 CGGGATCGCGGCGGCGGCGGCGG - Intronic