ID: 946323459

View in Genome Browser
Species Human (GRCh38)
Location 2:218968338-218968360
Sequence GCATGCCCACACACAGAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946323455_946323459 22 Left 946323455 2:218968293-218968315 CCAGCCTGGCAGCCATGTCTATT No data
Right 946323459 2:218968338-218968360 GCATGCCCACACACAGAGCATGG No data
946323457_946323459 10 Left 946323457 2:218968305-218968327 CCATGTCTATTACACACAAAGCA No data
Right 946323459 2:218968338-218968360 GCATGCCCACACACAGAGCATGG No data
946323456_946323459 18 Left 946323456 2:218968297-218968319 CCTGGCAGCCATGTCTATTACAC No data
Right 946323459 2:218968338-218968360 GCATGCCCACACACAGAGCATGG No data
946323454_946323459 27 Left 946323454 2:218968288-218968310 CCTGTCCAGCCTGGCAGCCATGT No data
Right 946323459 2:218968338-218968360 GCATGCCCACACACAGAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946323459 Original CRISPR GCATGCCCACACACAGAGCA TGG Intergenic
No off target data available for this crispr