ID: 946326067

View in Genome Browser
Species Human (GRCh38)
Location 2:218985262-218985284
Sequence TTAGCTGGAAGCGTTTCTCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 77}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946326067_946326075 10 Left 946326067 2:218985262-218985284 CCTGGAGAAACGCTTCCAGCTAA 0: 1
1: 0
2: 0
3: 12
4: 77
Right 946326075 2:218985295-218985317 GGAACCCTCCGGCCCCCGCGCGG 0: 1
1: 0
2: 0
3: 6
4: 110
946326067_946326080 17 Left 946326067 2:218985262-218985284 CCTGGAGAAACGCTTCCAGCTAA 0: 1
1: 0
2: 0
3: 12
4: 77
Right 946326080 2:218985302-218985324 TCCGGCCCCCGCGCGGCCCGGGG 0: 1
1: 0
2: 1
3: 32
4: 320
946326067_946326078 15 Left 946326067 2:218985262-218985284 CCTGGAGAAACGCTTCCAGCTAA 0: 1
1: 0
2: 0
3: 12
4: 77
Right 946326078 2:218985300-218985322 CCTCCGGCCCCCGCGCGGCCCGG 0: 1
1: 0
2: 6
3: 47
4: 356
946326067_946326079 16 Left 946326067 2:218985262-218985284 CCTGGAGAAACGCTTCCAGCTAA 0: 1
1: 0
2: 0
3: 12
4: 77
Right 946326079 2:218985301-218985323 CTCCGGCCCCCGCGCGGCCCGGG 0: 1
1: 0
2: 5
3: 58
4: 449
946326067_946326073 -1 Left 946326067 2:218985262-218985284 CCTGGAGAAACGCTTCCAGCTAA 0: 1
1: 0
2: 0
3: 12
4: 77
Right 946326073 2:218985284-218985306 AGGGGCCGCTTGGAACCCTCCGG 0: 1
1: 0
2: 0
3: 8
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946326067 Original CRISPR TTAGCTGGAAGCGTTTCTCC AGG (reversed) Exonic