ID: 946326072

View in Genome Browser
Species Human (GRCh38)
Location 2:218985277-218985299
Sequence GTTCCAAGCGGCCCCTTAGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 50
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 48}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946326072_946326080 2 Left 946326072 2:218985277-218985299 CCAGCTAAGGGGCCGCTTGGAAC 0: 1
1: 0
2: 0
3: 1
4: 48
Right 946326080 2:218985302-218985324 TCCGGCCCCCGCGCGGCCCGGGG 0: 1
1: 0
2: 1
3: 32
4: 320
946326072_946326078 0 Left 946326072 2:218985277-218985299 CCAGCTAAGGGGCCGCTTGGAAC 0: 1
1: 0
2: 0
3: 1
4: 48
Right 946326078 2:218985300-218985322 CCTCCGGCCCCCGCGCGGCCCGG 0: 1
1: 0
2: 6
3: 47
4: 356
946326072_946326079 1 Left 946326072 2:218985277-218985299 CCAGCTAAGGGGCCGCTTGGAAC 0: 1
1: 0
2: 0
3: 1
4: 48
Right 946326079 2:218985301-218985323 CTCCGGCCCCCGCGCGGCCCGGG 0: 1
1: 0
2: 5
3: 58
4: 449
946326072_946326075 -5 Left 946326072 2:218985277-218985299 CCAGCTAAGGGGCCGCTTGGAAC 0: 1
1: 0
2: 0
3: 1
4: 48
Right 946326075 2:218985295-218985317 GGAACCCTCCGGCCCCCGCGCGG 0: 1
1: 0
2: 0
3: 6
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946326072 Original CRISPR GTTCCAAGCGGCCCCTTAGC TGG (reversed) Exonic