ID: 946326074

View in Genome Browser
Species Human (GRCh38)
Location 2:218985289-218985311
Sequence GGGGGCCGGAGGGTTCCAAG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 171}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946326074_946326080 -10 Left 946326074 2:218985289-218985311 CCGCTTGGAACCCTCCGGCCCCC 0: 1
1: 0
2: 2
3: 14
4: 171
Right 946326080 2:218985302-218985324 TCCGGCCCCCGCGCGGCCCGGGG 0: 1
1: 0
2: 1
3: 32
4: 320
946326074_946326090 28 Left 946326074 2:218985289-218985311 CCGCTTGGAACCCTCCGGCCCCC 0: 1
1: 0
2: 2
3: 14
4: 171
Right 946326090 2:218985340-218985362 TAATTAAAGCGCTGCCGCCTCGG 0: 1
1: 0
2: 0
3: 2
4: 34

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946326074 Original CRISPR GGGGGCCGGAGGGTTCCAAG CGG (reversed) Exonic