ID: 946326075 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:218985295-218985317 |
| Sequence | GGAACCCTCCGGCCCCCGCG CGG |
| Strand | + |
| Crispr in exon? | Yes |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 117 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 6, 4: 110} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 946326067_946326075 | 10 | Left | 946326067 | 2:218985262-218985284 | CCTGGAGAAACGCTTCCAGCTAA | 0: 1 1: 0 2: 0 3: 12 4: 77 |
||
| Right | 946326075 | 2:218985295-218985317 | GGAACCCTCCGGCCCCCGCGCGG | 0: 1 1: 0 2: 0 3: 6 4: 110 |
||||
| 946326072_946326075 | -5 | Left | 946326072 | 2:218985277-218985299 | CCAGCTAAGGGGCCGCTTGGAAC | 0: 1 1: 0 2: 0 3: 1 4: 48 |
||
| Right | 946326075 | 2:218985295-218985317 | GGAACCCTCCGGCCCCCGCGCGG | 0: 1 1: 0 2: 0 3: 6 4: 110 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 946326075 | Original CRISPR | GGAACCCTCCGGCCCCCGCG CGG | Exonic | ||