ID: 946326075

View in Genome Browser
Species Human (GRCh38)
Location 2:218985295-218985317
Sequence GGAACCCTCCGGCCCCCGCG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 110}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946326067_946326075 10 Left 946326067 2:218985262-218985284 CCTGGAGAAACGCTTCCAGCTAA 0: 1
1: 0
2: 0
3: 12
4: 77
Right 946326075 2:218985295-218985317 GGAACCCTCCGGCCCCCGCGCGG 0: 1
1: 0
2: 0
3: 6
4: 110
946326072_946326075 -5 Left 946326072 2:218985277-218985299 CCAGCTAAGGGGCCGCTTGGAAC 0: 1
1: 0
2: 0
3: 1
4: 48
Right 946326075 2:218985295-218985317 GGAACCCTCCGGCCCCCGCGCGG 0: 1
1: 0
2: 0
3: 6
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946326075 Original CRISPR GGAACCCTCCGGCCCCCGCG CGG Exonic