ID: 946326078

View in Genome Browser
Species Human (GRCh38)
Location 2:218985300-218985322
Sequence CCTCCGGCCCCCGCGCGGCC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 410
Summary {0: 1, 1: 0, 2: 6, 3: 47, 4: 356}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946326067_946326078 15 Left 946326067 2:218985262-218985284 CCTGGAGAAACGCTTCCAGCTAA 0: 1
1: 0
2: 0
3: 12
4: 77
Right 946326078 2:218985300-218985322 CCTCCGGCCCCCGCGCGGCCCGG 0: 1
1: 0
2: 6
3: 47
4: 356
946326072_946326078 0 Left 946326072 2:218985277-218985299 CCAGCTAAGGGGCCGCTTGGAAC 0: 1
1: 0
2: 0
3: 1
4: 48
Right 946326078 2:218985300-218985322 CCTCCGGCCCCCGCGCGGCCCGG 0: 1
1: 0
2: 6
3: 47
4: 356

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946326078 Original CRISPR CCTCCGGCCCCCGCGCGGCC CGG Exonic