ID: 946326080

View in Genome Browser
Species Human (GRCh38)
Location 2:218985302-218985324
Sequence TCCGGCCCCCGCGCGGCCCG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 354
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 320}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946326074_946326080 -10 Left 946326074 2:218985289-218985311 CCGCTTGGAACCCTCCGGCCCCC 0: 1
1: 0
2: 2
3: 14
4: 171
Right 946326080 2:218985302-218985324 TCCGGCCCCCGCGCGGCCCGGGG 0: 1
1: 0
2: 1
3: 32
4: 320
946326072_946326080 2 Left 946326072 2:218985277-218985299 CCAGCTAAGGGGCCGCTTGGAAC 0: 1
1: 0
2: 0
3: 1
4: 48
Right 946326080 2:218985302-218985324 TCCGGCCCCCGCGCGGCCCGGGG 0: 1
1: 0
2: 1
3: 32
4: 320
946326067_946326080 17 Left 946326067 2:218985262-218985284 CCTGGAGAAACGCTTCCAGCTAA 0: 1
1: 0
2: 0
3: 12
4: 77
Right 946326080 2:218985302-218985324 TCCGGCCCCCGCGCGGCCCGGGG 0: 1
1: 0
2: 1
3: 32
4: 320

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946326080 Original CRISPR TCCGGCCCCCGCGCGGCCCG GGG Exonic