ID: 946326146

View in Genome Browser
Species Human (GRCh38)
Location 2:218985538-218985560
Sequence CTGTTTGCAGAGAGTCAGGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 305
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 285}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946326146_946326153 -2 Left 946326146 2:218985538-218985560 CCTCCCTGACTCTCTGCAAACAG 0: 1
1: 0
2: 1
3: 18
4: 285
Right 946326153 2:218985559-218985581 AGTGATGGGGCTGGTGTACCCGG 0: 1
1: 0
2: 2
3: 23
4: 175
946326146_946326154 9 Left 946326146 2:218985538-218985560 CCTCCCTGACTCTCTGCAAACAG 0: 1
1: 0
2: 1
3: 18
4: 285
Right 946326154 2:218985570-218985592 TGGTGTACCCGGCCCCACCTCGG 0: 1
1: 0
2: 1
3: 6
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946326146 Original CRISPR CTGTTTGCAGAGAGTCAGGG AGG (reversed) Exonic
902602525 1:17550026-17550048 CTGGCTGTAGAGAGCCAGGGTGG + Intronic
902727545 1:18347165-18347187 CTGTGTTCAGAGAGGGAGGGAGG - Intronic
903268571 1:22173766-22173788 CTGTCTGCAGAGGGGCAGGAAGG - Intergenic
903806597 1:26010159-26010181 CTCTTTTCAGAGAGTCAGCCAGG - Intergenic
904836772 1:33342702-33342724 CTGGCTGCAGGGAGTCAGGGAGG + Intronic
905008319 1:34729244-34729266 CTGCTTGCAGAGACCCACGGAGG - Intronic
905348118 1:37325480-37325502 CTGTTTGCAAAGAATTAGAGAGG + Intergenic
905462383 1:38130160-38130182 CTGAATGCAGTGAGTCAGAGAGG + Intergenic
907221633 1:52911427-52911449 GTGAATGCAGAGACTCAGGGAGG - Intronic
907282719 1:53361647-53361669 CTGTGCGCAGGGAGTCAGAGTGG + Intergenic
908348050 1:63255855-63255877 GTGTATGCAGAGAGACAGAGAGG - Intergenic
909224165 1:72995018-72995040 GTGTTTGCAGAGATACAAGGAGG - Intergenic
910347380 1:86255505-86255527 CTGATTTCAGAGAGTCAGTGTGG - Intergenic
911655630 1:100439977-100439999 CTGTTTGCAGGGAATCAGAAAGG + Exonic
913212744 1:116595080-116595102 ATGCATGCAGAGAGACAGGGAGG + Intronic
914806312 1:150994752-150994774 CTGTGTGCAGGGAGTGAGGGTGG - Intronic
916192663 1:162194330-162194352 TTGTTTGCAGAGAGCCTGGTTGG + Intronic
916890287 1:169106721-169106743 CTGCCTGCAGAGAGCCAGGCCGG + Exonic
917600675 1:176570767-176570789 CTGTAAGCAGAGAGCCAGAGGGG - Intronic
920530665 1:206699737-206699759 CTGCATGCAGGGAGACAGGGAGG + Intronic
920554602 1:206895526-206895548 CTGTCTGCAGATAGGCGGGGAGG - Intergenic
922084410 1:222332375-222332397 CCTTTTCCAGAGAGTGAGGGAGG - Intergenic
922126990 1:222737499-222737521 CTCTCTGCAGAGAGAGAGGGCGG + Intronic
922481432 1:225942084-225942106 GTGTTTGAAGAGACACAGGGGGG - Intergenic
1065815486 10:29479222-29479244 CTGCGGGCAGAGAGTCAGAGTGG - Intronic
1065957456 10:30705999-30706021 CTGCATGCAGGGAGTCAGAGTGG + Intergenic
1067434163 10:46265604-46265626 TTGGTTGCAGGGAGTCAGAGGGG + Intergenic
1067739569 10:48884265-48884287 CTGTTTGTAGAAGGTGAGGGTGG + Intronic
1070714582 10:78710037-78710059 CCTGTTGCAGGGAGTCAGGGTGG + Intergenic
1071469648 10:85974670-85974692 CTGGTTGCAGAAAGTCAAGAGGG - Intronic
1071953204 10:90728414-90728436 ATGTTTTAAGAGGGTCAGGGTGG + Intergenic
1072474405 10:95745915-95745937 CTATTTCCAGGTAGTCAGGGAGG - Intronic
1072633022 10:97159822-97159844 GTGTTTGTTGAGAGTCAGGAGGG - Intronic
1073130371 10:101184886-101184908 CGGCTTGCAGAGAGTGAGTGAGG + Intergenic
1073676332 10:105650884-105650906 ATGTTTGCAGAGAGTTAGAATGG + Intergenic
1074052503 10:109892875-109892897 CTTTCTGCAGAGAGTCAATGTGG + Intronic
1074541293 10:114367280-114367302 CTGTTTGCAGACAGGCATGTGGG + Intronic
1074699932 10:116083897-116083919 ATGTTTGCAGAGTGGCAGGAGGG - Intronic
1075411033 10:122228124-122228146 CTGTGGTCAGGGAGTCAGGGTGG - Intronic
1076266007 10:129110447-129110469 CAGCTTGCACAGAGGCAGGGAGG - Intergenic
1076649266 10:131976621-131976643 CTGGTTGCAGAGAGTGTGGTTGG - Intronic
1076654156 10:132011187-132011209 TTGTTTGCATACAGTCAGGCAGG + Intergenic
1076849659 10:133086676-133086698 CGGTGTCCAGGGAGTCAGGGCGG + Intronic
1077264292 11:1641428-1641450 CTGTTAGCAGAGAGAAGGGGAGG + Intergenic
1081647953 11:44802955-44802977 ATGTTTGGGGAGAGTCATGGCGG + Intronic
1083511254 11:63211123-63211145 CTGTTTGCAGCAAGTCCAGGGGG - Intronic
1083540316 11:63507623-63507645 ATGCTTGGAAAGAGTCAGGGTGG + Intronic
1084955434 11:72688831-72688853 CAGTTTGCAGGGCATCAGGGTGG - Intronic
1085946359 11:81277904-81277926 CAGTTTGCACAGAGAGAGGGAGG - Intergenic
1087456819 11:98396880-98396902 CAGTTTGAGGAGAGTCAGGAGGG + Intergenic
1087663641 11:101016761-101016783 GTGTTTGCAGGGAGTGAGTGTGG + Intergenic
1088318061 11:108527376-108527398 CTTTTTGCAAAGAGAGAGGGAGG + Intronic
1088548170 11:110982514-110982536 CTGTCTGCTGAGAGTAAGGCTGG + Intergenic
1090695754 11:129239775-129239797 CTGTTTGCACAGATTGAGGATGG - Intronic
1090798523 11:130155976-130155998 CTGTTTGGAGACAGTGAGCGAGG - Intergenic
1091078495 11:132643433-132643455 CTGCATGCAGAGCCTCAGGGAGG + Intronic
1092690950 12:11109262-11109284 CTCTTTTCAGAGTGTCAGGCAGG - Intronic
1092847075 12:12593725-12593747 CTGTTTGTACAGAGTCATGATGG - Intergenic
1093435675 12:19130931-19130953 CTGTTTGGAGGGAGTCCGTGGGG + Intronic
1093775321 12:23067046-23067068 CTGTTTGTAGAGTTGCAGGGAGG + Intergenic
1096230762 12:49895617-49895639 CTGTCTGCAGGCAGGCAGGGAGG - Intronic
1097293920 12:57943056-57943078 CTGCTTGTAGAGACTCAGGGAGG + Intronic
1098304693 12:69090788-69090810 CTGTTTGCAGAGAACAAGGATGG + Intergenic
1098387231 12:69932348-69932370 TTGTTTTCAGAGAGGCAGGGAGG + Intronic
1098893466 12:76031975-76031997 CTGTTAGCAGAGAGTCCCGCGGG - Exonic
1100208047 12:92372763-92372785 CTGTCAGCAGAGAGTCCAGGTGG - Intergenic
1101775469 12:107789326-107789348 TTGTTTGCACAGAGAGAGGGAGG + Intergenic
1102549064 12:113677839-113677861 TTTTTGGCAGAGAGTGAGGGCGG + Intergenic
1105215994 13:18285711-18285733 ATGCATGCAGAGAGACAGGGAGG + Intergenic
1105705270 13:22964423-22964445 CTGTGAGCAGGGAGTCAGGGCGG - Intergenic
1105705966 13:22967583-22967605 CTGTGTGCTGAGATACAGGGGGG - Intergenic
1105819883 13:24070781-24070803 CAGTTTGAAGACAGTCAGGGAGG - Intronic
1105858867 13:24392567-24392589 CTGTGTGCTGAGATACAGGGGGG - Intergenic
1108463689 13:50693532-50693554 CAGTTTACAGAGAGGGAGGGTGG - Intronic
1109931729 13:69225184-69225206 CTTTCTGGAGAGAGTAAGGGAGG + Intergenic
1111897416 13:94158524-94158546 CTGTTTGCTGAAAGTTAGGCTGG - Intronic
1117692120 14:58318604-58318626 CATTTTGCAGAGAGTGAGGTAGG + Exonic
1117786076 14:59286919-59286941 CTGGTTTTAGAGAGTTAGGGAGG - Intronic
1118292640 14:64540500-64540522 CTGGCGGCCGAGAGTCAGGGAGG + Intronic
1118951663 14:70441193-70441215 CTGTTTCCACACAGTCATGGAGG + Intergenic
1120218795 14:81709644-81709666 CTGTCTGCAGAAAGTCAATGGGG - Intergenic
1120317885 14:82919568-82919590 ATGTTGGCAGAGAGACATGGTGG - Intergenic
1120682602 14:87498634-87498656 CTGTCTTCATGGAGTCAGGGTGG - Intergenic
1121403455 14:93703150-93703172 GAGTGTGCAGAGAGTCGGGGAGG - Intronic
1121720605 14:96106022-96106044 CTGCTTGCACAGAGTAAGCGGGG - Intergenic
1123831706 15:24145876-24145898 TTTTTTCCAGAGAGACAGGGAGG + Intergenic
1124997477 15:34737629-34737651 CTGTCAGCAGAGTGTCAGGCTGG - Intergenic
1125531176 15:40414552-40414574 CTGTGTAGAAAGAGTCAGGGAGG + Intronic
1126103346 15:45132954-45132976 CACTCAGCAGAGAGTCAGGGGGG - Intronic
1127131465 15:55868872-55868894 TTGTTTGCAGAGTGACAGGATGG - Intronic
1127484709 15:59408243-59408265 CTGATAGCAGAAAATCAGGGTGG + Intronic
1128233001 15:66048521-66048543 TTGTGGGCAGGGAGTCAGGGTGG - Intronic
1128708322 15:69853390-69853412 ATCTTTGCAGACAGGCAGGGTGG - Intergenic
1128935150 15:71739740-71739762 CAGTTTGCAGAGATTCCTGGGGG - Intronic
1129896804 15:79114475-79114497 TTGGATGCTGAGAGTCAGGGAGG - Intergenic
1130222620 15:82033298-82033320 CAGATTGTAGAGAGTCTGGGAGG - Intergenic
1132407881 15:101555415-101555437 CTGTTTTCCCTGAGTCAGGGAGG - Intergenic
1133117375 16:3585209-3585231 CTGTTTGAAGAGTATCAGTGTGG - Intronic
1133788239 16:8989438-8989460 CTGCTTGCAGTGAAACAGGGCGG + Intergenic
1134104772 16:11477667-11477689 CTGTGTGCAGAGATGCTGGGTGG - Intronic
1134511898 16:14855150-14855172 GAGTTTGCAGGGTGTCAGGGTGG + Intronic
1134699540 16:16253649-16253671 GAGTTTGCAGGGTGTCAGGGTGG + Intronic
1134972288 16:18541022-18541044 GAGTTTGCAGGGTGTCAGGGTGG - Intronic
1135224107 16:20640619-20640641 CTGAATGCACAGAGCCAGGGTGG - Intronic
1135613617 16:23890256-23890278 AGGTTTGCAGAGAGGCAGTGAGG - Intronic
1135730673 16:24892542-24892564 CTGTGGGCAGGGAGGCAGGGCGG + Intronic
1139002600 16:62531270-62531292 CTATTTCCAGAGACTGAGGGAGG + Intergenic
1139182847 16:64768154-64768176 GTGTTTGCAAAGATTCTGGGAGG + Intergenic
1139272736 16:65698958-65698980 CTGTCTGCAGAGAGAGAGAGAGG + Intergenic
1140349308 16:74246785-74246807 CAGTTTGAAGACAGTCAGGCAGG - Intergenic
1142673568 17:1499313-1499335 CTTTTAGTAGAGAGTCAGGATGG - Intronic
1144431602 17:15197497-15197519 TTGTTTACAGAGAGTCAAGAAGG - Intergenic
1144952472 17:19001717-19001739 CTGTAGCCAGAGACTCAGGGAGG + Intronic
1145270845 17:21404176-21404198 TGGTTTGCACACAGTCAGGGTGG + Intronic
1145309050 17:21691563-21691585 TGGTTTGCACACAGTCAGGGTGG + Intergenic
1146511538 17:33453441-33453463 CTTTTTGAAAAGAGGCAGGGAGG + Intronic
1146808962 17:35888378-35888400 CTCTTTGCACAGAGTCAGTCAGG - Intergenic
1146944616 17:36865121-36865143 CTGATTGGAGAATGTCAGGGAGG - Intergenic
1148444093 17:47727269-47727291 CTGTCTGCTGAGAGGCAGGAAGG + Intergenic
1149779121 17:59382278-59382300 CTGTTTTGAGAGAGTCTGCGGGG - Intronic
1150125160 17:62630468-62630490 CTGTCTGGAGAGAGGCAGGAAGG + Intronic
1150138216 17:62707313-62707335 ATGTTTGGGGAAAGTCAGGGAGG - Intronic
1151769049 17:76147724-76147746 CTGTCTGCGGAAAGTCAGTGTGG + Intronic
1151965556 17:77429461-77429483 ATGTTGGCAGAGAATCAGAGAGG + Intronic
1152329447 17:79663681-79663703 TTGTTGGCTGAGGGTCAGGGGGG - Intergenic
1152406033 17:80098427-80098449 CTATTTGCAGTGCTTCAGGGCGG + Intronic
1152739011 17:82011032-82011054 CAGTTCGCAGAGTGTCAGGCAGG + Intronic
1153826397 18:8878872-8878894 CAGTCTGAAGAGAGTCAGGAGGG + Intergenic
1154063853 18:11088277-11088299 CTTTTAGAAGAGAGTCAGAGTGG - Intronic
1154959230 18:21291276-21291298 AGGTTTGGGGAGAGTCAGGGCGG - Intronic
1156474703 18:37398137-37398159 CTGTTGGGAGAGAGTGAAGGAGG + Intronic
1156570717 18:38249891-38249913 CAGTATACAGAGAGGCAGGGAGG + Intergenic
1156698454 18:39795769-39795791 CAGTTTGCAGAGGGAGAGGGAGG + Intergenic
1157559536 18:48636836-48636858 CTGTGGGCAGGGAGTTAGGGAGG - Intronic
1159308280 18:66674312-66674334 CTATTAGCAGAGAGAAAGGGGGG - Intergenic
1159774630 18:72589243-72589265 ATGTTTGCTGAGAGTAAGAGAGG + Intronic
1159784491 18:72697157-72697179 CAGTTTGCACAGAGAGAGGGAGG - Intergenic
1160506184 18:79427877-79427899 CTCTGTGCAGTGAGTCGGGGAGG + Intronic
1161660335 19:5541836-5541858 CTTTCTGCAGAGAGGAAGGGAGG + Intergenic
1161719548 19:5895368-5895390 CTCTTTGAAGAGAGACAGGGAGG + Intronic
1162514266 19:11138738-11138760 CTGTCTGCAGTGAGTCAGCCTGG + Intronic
1163207713 19:15815708-15815730 CGGTGGGCAGGGAGTCAGGGAGG - Intergenic
1163784300 19:19266725-19266747 CACTTTGCAGAGAGCCTGGGTGG - Intronic
1163822269 19:19502730-19502752 CTGGGTGCAGAGAGTGAGGGTGG - Intronic
1163867105 19:19782665-19782687 CAGTCTGAGGAGAGTCAGGGGGG + Intergenic
1166190725 19:41174868-41174890 CCGAGTGCAGAAAGTCAGGGCGG + Intergenic
1166699288 19:44873047-44873069 CTGTGTGAAGAGTGCCAGGGTGG - Intronic
1167211266 19:48135623-48135645 CTGTGGGCAGAGTGCCAGGGTGG - Intronic
1167489764 19:49785553-49785575 TGGATTGCAGGGAGTCAGGGCGG + Intronic
1167737121 19:51301674-51301696 CTGGTTGGGGAGAGTCCGGGAGG - Intergenic
1167747298 19:51359446-51359468 CTTCTTGCTGTGAGTCAGGGAGG + Intronic
1168557221 19:57353215-57353237 CTGCTTGCAGAGTGGCATGGGGG + Intronic
924998782 2:387068-387090 CTGTTTGGAGAAAGTGAAGGGGG - Intergenic
925425485 2:3746085-3746107 CTGTTGGCTGAGTGCCAGGGAGG + Intronic
925651288 2:6092178-6092200 CTATTTGCCCAGAGTCAGGATGG - Intergenic
926314671 2:11700568-11700590 CTGCCTCCAGAGAGGCAGGGAGG - Intronic
927204011 2:20595578-20595600 CCCTTCGCAGAGAGTCAGGCAGG - Intronic
930020358 2:46998141-46998163 CTGTTTGCACTGAGGCTGGGAGG + Intronic
932996324 2:76858316-76858338 CAGTTTGAAAAGAGTCAGGTGGG - Intronic
933227553 2:79768238-79768260 CTCTTTGCATGGGGTCAGGGAGG + Intronic
934298334 2:91761015-91761037 ATGCATGCAGAGAGACAGGGAGG - Intergenic
935026956 2:99286126-99286148 CTCTTTGCAGAGTCCCAGGGTGG - Intronic
935401176 2:102662190-102662212 CTCTTTGCAGAGTCTAAGGGGGG + Intronic
938894513 2:135736893-135736915 TTATTTGCTGAGAGTAAGGGGGG - Intergenic
939616333 2:144365382-144365404 CTCTTTCCAGAGTGTCAGGAGGG - Intergenic
939655165 2:144815745-144815767 CTTTTTGCAGAGAGCAAAGGTGG + Intergenic
942222791 2:173787893-173787915 CAGTCTGGAGAGAGTCTGGGTGG - Intergenic
942575862 2:177362859-177362881 CTATTTGCTGAGAGTGAGGCAGG - Intronic
946246430 2:218390453-218390475 CAGATCCCAGAGAGTCAGGGAGG - Intronic
946326146 2:218985538-218985560 CTGTTTGCAGAGAGTCAGGGAGG - Exonic
946881734 2:224183211-224183233 CTGTTAGAAGAGGGTCAGGAAGG + Intergenic
947031349 2:225799597-225799619 ATGTTTGCTGAGAGTCTGCGGGG - Intergenic
948328807 2:237149190-237149212 CTGTTCCCATAGAGTCATGGTGG - Intergenic
948909791 2:240997311-240997333 CTGTTTGCAGAGAGGCAAACTGG - Intergenic
1168810578 20:701926-701948 CTGTTTGGTGACAGACAGGGAGG - Intergenic
1168841813 20:914543-914565 GTGTTAGCAGGGAGCCAGGGGGG + Intronic
1170902793 20:20482445-20482467 GTGTTGGCAGAGATTCACGGTGG + Intronic
1170919866 20:20667890-20667912 CTGTTTGCAGAGGGTCACTTTGG + Intronic
1172045130 20:32074695-32074717 CTGTCTCCAGAGAGTCAACGCGG - Exonic
1174752386 20:53124268-53124290 CTGATTGCAGACATGCAGGGGGG - Intronic
1175443322 20:59005382-59005404 CTTTTTGCAGAGAGATGGGGAGG - Intronic
1175473890 20:59255065-59255087 TTGATTGCAGAGAGGCAGTGGGG - Exonic
1175942413 20:62543585-62543607 CAGTTGGGAGAGAGGCAGGGTGG - Intergenic
1176884647 21:14241023-14241045 CTTATTGGAGAGAGTCAAGGTGG + Intergenic
1178826219 21:36019097-36019119 TTGCTTGGAGAGAGGCAGGGTGG - Intergenic
1179270671 21:39848130-39848152 CAGTTTGCAAAGAGAGAGGGTGG + Intergenic
1179798821 21:43800981-43801003 CTCTTTGCAGAGAGGCCTGGTGG + Intronic
1182364951 22:29772316-29772338 CTGTTGGCAGAGAGACATGGAGG + Intergenic
1184470516 22:44693003-44693025 CAGTGTGCTGAGTGTCAGGGTGG + Intronic
1184515315 22:44958261-44958283 GTGTAGGGAGAGAGTCAGGGAGG - Intronic
1184573372 22:45341525-45341547 GAGTTTGCAGAGAGTGAGGGAGG + Exonic
1185089342 22:48757124-48757146 CTCTTTGGAGAGAGGCAAGGAGG + Intronic
950151981 3:10694842-10694864 CTGTCAGCAGAGAGGGAGGGGGG - Intronic
952512497 3:34071255-34071277 CTGTATGAGGAGAGCCAGGGTGG + Intergenic
954327286 3:49870353-49870375 GTGTTTGCAGGTAGTCAGTGTGG + Intergenic
954908096 3:54079886-54079908 CTGTTACCAGAGAGACAGTGGGG - Intergenic
955235570 3:57136186-57136208 CTCTTTCCAGAGAGTCAGGGTGG + Intronic
956017146 3:64895537-64895559 CTGTTTCCAGAAAGTCACTGGGG - Intergenic
957825122 3:85431713-85431735 TTGTTTGCTGAGAGTCAGAAGGG + Intronic
962293687 3:134160527-134160549 TTGTTTGCATAGATTCTGGGGGG - Intronic
963542842 3:146616433-146616455 CTATTTGCTGAAAGTTAGGGTGG - Intergenic
964761072 3:160135620-160135642 CTGTCAGCAGTGAGTCTGGGTGG - Intergenic
965040492 3:163500411-163500433 CTCTTTGCAGAGTCTCTGGGAGG + Intergenic
965213399 3:165826498-165826520 CTGTTTGCAAAGAGGTGGGGGGG + Intronic
965368966 3:167837000-167837022 GTGTTTGCAGAGTGGGAGGGTGG + Intergenic
965449213 3:168816825-168816847 CTGAAGGCAGAGAGTCAGTGAGG + Intergenic
967579016 3:191129871-191129893 CTGTTGGAAGAGAGGCAGGGAGG + Intergenic
968752933 4:2399619-2399641 CCGTTTTGAGAGGGTCAGGGAGG + Intronic
969184938 4:5468023-5468045 CTGTTTGGAGACTGTCCGGGAGG + Exonic
969496458 4:7529196-7529218 ATGTTTGCACAGAGTCTGGAAGG - Intronic
970742320 4:19252322-19252344 CTGTTGGCACAGAGTCAGGAGGG - Intergenic
972921002 4:43941699-43941721 CAGTCTGCAGAGAGGCAGGAAGG - Intergenic
973651862 4:53004747-53004769 CTGTCTTCAGGGTGTCAGGGTGG - Intronic
974147667 4:57967173-57967195 CTGTTTGCAGGGAGTTGTGGAGG + Intergenic
976345361 4:83993735-83993757 CAGTTTGCATAGGGTGAGGGAGG - Intergenic
976815940 4:89148597-89148619 CTGCTTGCAGGGAGGCGGGGTGG + Intergenic
980302182 4:131009839-131009861 CTGTTTGCATACAGTCAAGCAGG - Intergenic
983293346 4:165834335-165834357 ATGTTGGCAGAGAGAGAGGGAGG + Intergenic
984926926 4:184815262-184815284 CTGTGAGCAAAGAGGCAGGGAGG + Intronic
989641993 5:43591795-43591817 GTCTTTGCTGAGAGTGAGGGTGG + Intergenic
990462839 5:56045824-56045846 CTGATTGCAGAGAATCAAGTTGG - Intergenic
991725223 5:69529115-69529137 CTGACTTCAGGGAGTCAGGGTGG + Intronic
992200232 5:74376320-74376342 GTATTTGGAGAGAGTCTGGGAGG + Intergenic
992624852 5:78627639-78627661 ATGTTTGCAGAGAGGGAGTGAGG - Intronic
993647166 5:90475244-90475266 CTGTTTGCAGTGAGTTAGAAGGG + Intronic
994028677 5:95114942-95114964 CTGTTTGGAGAAAGTAAGGAAGG + Intronic
994273250 5:97807142-97807164 CTGTTTGCACAGGGAGAGGGAGG + Intergenic
994596944 5:101851086-101851108 CTCTTTGCAGAGCATCAGGGTGG - Intergenic
995695794 5:114876813-114876835 CTGTTTTCAGAGTGTCAGGCAGG - Intergenic
997460293 5:134047284-134047306 GTGATTGCAGAGACTCAGGTAGG + Intergenic
998505031 5:142665545-142665567 CTGGATGCAGTGAGCCAGGGTGG - Intronic
999254018 5:150199516-150199538 CTGCTTGAAGAGAGACATGGAGG + Intronic
999409968 5:151342227-151342249 TTGAGGGCAGAGAGTCAGGGAGG - Intronic
1000267569 5:159652404-159652426 CTCTCTGCAGATTGTCAGGGTGG - Intergenic
1001820436 5:174705952-174705974 ATGTGTGGAGAGAGGCAGGGAGG - Intergenic
1002672039 5:180875414-180875436 CTGTTGGCAGAAAGGCTGGGAGG + Intergenic
1003669569 6:8143820-8143842 CTGTTTGCAGCCAGGCATGGTGG - Intergenic
1005068062 6:21837884-21837906 CTGTTTGTAGAGAGTCTGCTAGG + Intergenic
1005562948 6:27060050-27060072 CTCTTTGCAGATAGACAGTGGGG - Intergenic
1007641381 6:43342622-43342644 AAGTTTGAAGAGAGTGAGGGTGG + Intronic
1007672932 6:43571282-43571304 CAGTTTGCAGAAGGCCAGGGAGG + Intronic
1008783510 6:55137315-55137337 CTGTTTTCAGAGTGTAAGGAAGG - Intronic
1009696978 6:67118855-67118877 CTGTTTGCAGAGTGTACTGGAGG + Intergenic
1009922150 6:70075334-70075356 CTGTTTGCAGAGCTCCATGGTGG + Intronic
1011074242 6:83421008-83421030 CTGTATGCAGACAGGGAGGGGGG + Intronic
1014707497 6:124765731-124765753 CAGTTTTTAGAGATTCAGGGTGG - Intronic
1017905576 6:158755605-158755627 CTGTTTGCAGAGGCTGAAGGAGG + Intronic
1018641493 6:165908220-165908242 CTGTTCGCAGAGAGCCAGCGAGG + Intronic
1019075869 6:169387757-169387779 CTGTAGGCAGAGAGGCAGGTAGG - Intergenic
1019416888 7:931960-931982 CTGAGTGCAGGGAGCCAGGGGGG + Intronic
1019607745 7:1918531-1918553 CTGTTTGCAGGCAGCCAGGCGGG + Intronic
1021468842 7:20978599-20978621 CTGGATGCAGAGAGGCAGTGAGG - Intergenic
1021763207 7:23921438-23921460 TTGTTTGCTGAGAGCAAGGGAGG + Intergenic
1023100354 7:36711693-36711715 CTGTGTCCAGAGAATGAGGGTGG + Intronic
1024722537 7:52153561-52153583 CTGTTTCCAGAAAGTTAAGGAGG + Intergenic
1024957037 7:54933266-54933288 CTGGTGGCAGAGAGGGAGGGAGG + Intergenic
1025201122 7:56962409-56962431 CTGTCTGCAGAGTCCCAGGGAGG - Intergenic
1025670822 7:63614523-63614545 CTGTCTGCAGAGTCCCAGGGAGG + Intergenic
1026294637 7:69040581-69040603 CTGCTGGCAGAGAGGCATGGTGG - Intergenic
1026622262 7:71960066-71960088 GTGGTTGCAGTGAGTCAGGATGG + Intronic
1029179192 7:98687733-98687755 CTGTTTGCAGATAGAACGGGTGG - Intergenic
1030069763 7:105688574-105688596 CTGTTTTCAGAGGGTCAGTCAGG + Intronic
1030741140 7:113111062-113111084 CTGTTTGCTGTGAGTGAGAGTGG + Intergenic
1031630960 7:124042383-124042405 CTTTTTTCAGAGAGGCAGTGTGG - Intergenic
1032107938 7:129050511-129050533 CTGGTTGCTCAGAGTCAGAGAGG - Intronic
1033067893 7:138173376-138173398 GTGTCTGAAGAAAGTCAGGGTGG + Intergenic
1034093644 7:148386683-148386705 CTGGTTGCTCAGTGTCAGGGAGG + Intronic
1035472804 7:159120965-159120987 CTTTTTGCAGAGGGTCAGCCAGG - Intronic
1036214160 8:6865280-6865302 CTGTGTGCTGAGAGTAAGTGGGG + Intergenic
1036719428 8:11159458-11159480 CTGTTAGCAGAAAGTGAGGCGGG - Intronic
1038032647 8:23656828-23656850 CTGTTTGCATAGATCCGGGGAGG - Intergenic
1042364124 8:67917090-67917112 CTGAGTCCAGAGGGTCAGGGAGG - Intergenic
1044603369 8:94027512-94027534 CAGTTGGCAGAGAGTCTTGGGGG - Intergenic
1045506903 8:102785191-102785213 CTGTTGGCAGGCAGTGAGGGGGG - Intergenic
1046846926 8:118927708-118927730 CTGTTTGGGGAGAGTCAAGCTGG + Intronic
1047063009 8:121249127-121249149 CTGGGTGAAGAGAGTCTGGGTGG - Intergenic
1048927492 8:139284071-139284093 CTGCTTGCAGAGGTGCAGGGCGG - Intergenic
1049632683 8:143667074-143667096 GTGTTTGCACAGAGGGAGGGAGG - Intergenic
1050719384 9:8568322-8568344 CTGTTAGTAGAGAGGGAGGGAGG - Intronic
1051697391 9:19783625-19783647 CTGATTGCAGAAACTTAGGGAGG - Intronic
1056685444 9:88755270-88755292 CTGTTTGCAGCCAGGCATGGTGG + Intergenic
1056899465 9:90584438-90584460 CAGTTTGCTGACAGTCAGTGTGG - Intergenic
1057233765 9:93342508-93342530 CAGTGTCCAGAGAGGCAGGGTGG + Intronic
1057252080 9:93511515-93511537 CAGTGTCCAGAGAGGCAGGGTGG - Intronic
1057448018 9:95132239-95132261 GTGTCTGCAGGGTGTCAGGGTGG - Intronic
1058009944 9:99965846-99965868 GTGTTTGCAAAGTGTGAGGGGGG - Intronic
1058545299 9:106054676-106054698 TTCTTTGCAGAAAGTCAGAGAGG - Intergenic
1060176719 9:121502587-121502609 CAGTTTGCAGAGAGAGAGAGAGG - Intergenic
1060547844 9:124471203-124471225 CTGGGTGCTGGGAGTCAGGGAGG + Intronic
1062383270 9:136297956-136297978 CTGCTTGGCGAGAGCCAGGGTGG + Intronic
1185466103 X:355017-355039 CTGTGTACAGAAAGTCAGGGAGG + Intronic
1186214501 X:7284282-7284304 CAGGTTTCAGGGAGTCAGGGAGG + Intronic
1187239118 X:17496362-17496384 CTGTTTGAGGTGGGTCAGGGAGG - Intronic
1187397780 X:18933251-18933273 CGGTGTGCAGAGAGGCAGAGGGG - Intronic
1188802592 X:34550141-34550163 CAGTTTGCACAGAGACAGAGAGG - Intergenic
1189771136 X:44428747-44428769 CTCTTTTCAGAGAATCAGGGTGG + Intergenic
1190342842 X:49311130-49311152 CTGTTTGCAGCAAGTCCAGGGGG - Intronic
1190633669 X:52413413-52413435 CTTTTTACAGAGAGGGAGGGAGG - Intergenic
1194091101 X:89582502-89582524 CTGTTTCCACACAGTCATGGAGG + Intergenic
1199862125 X:151810462-151810484 CTGTTTCTACAGAGTCAAGGTGG + Intergenic
1200259183 X:154602985-154603007 GAGTTAGGAGAGAGTCAGGGAGG - Intergenic
1202168522 Y:22017090-22017112 CTGTTTCCACAGAGTCATGAAGG - Intergenic
1202222839 Y:22569278-22569300 CTGTTTCCACAGAGTCATGAAGG + Intergenic
1202320276 Y:23626382-23626404 CTGTTTCCACAGAGTCATGAAGG - Intergenic
1202550491 Y:26043674-26043696 CTGTTTCCACAGAGTCATGAAGG + Intergenic