ID: 946326454

View in Genome Browser
Species Human (GRCh38)
Location 2:218986914-218986936
Sequence GTTCCCTGTGGACCAAACTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 112}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946326450_946326454 15 Left 946326450 2:218986876-218986898 CCTGGAATCTGGTGGGAGCAAAG 0: 1
1: 0
2: 2
3: 18
4: 225
Right 946326454 2:218986914-218986936 GTTCCCTGTGGACCAAACTCAGG 0: 1
1: 0
2: 2
3: 18
4: 112
946326446_946326454 30 Left 946326446 2:218986861-218986883 CCTTCAGGATGTGGACCTGGAAT 0: 1
1: 0
2: 0
3: 10
4: 137
Right 946326454 2:218986914-218986936 GTTCCCTGTGGACCAAACTCAGG 0: 1
1: 0
2: 2
3: 18
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946326454 Original CRISPR GTTCCCTGTGGACCAAACTC AGG Intergenic
904195886 1:28785162-28785184 GTTCCTTCTGTGCCAAACTCAGG - Intergenic
904537154 1:31207436-31207458 GTTCCCTGTAGTGCAGACTCTGG + Intronic
905450086 1:38050751-38050773 AAACCATGTGGACCAAACTCTGG - Intergenic
907253673 1:53161298-53161320 GTTCCCTGTGGACCAGCCACAGG - Intergenic
915735561 1:158082618-158082640 GTTCCCTCTGGACCCTCCTCTGG + Intronic
920543893 1:206799751-206799773 GCTGCCTGTGGACCAAGGTCAGG + Intronic
922720252 1:227896635-227896657 GGCCCCTGAGGACCACACTCCGG - Intergenic
1074365445 10:112854164-112854186 GTTTCCTGTGGAACCCACTCAGG - Intergenic
1078448298 11:11421444-11421466 GTTCCCTGTACACCAAACTGGGG - Intronic
1080023175 11:27585662-27585684 GTGGCCTGTGGCCCAAACTAGGG - Intergenic
1081776318 11:45678192-45678214 TTTCCCAGAAGACCAAACTCAGG + Intergenic
1084067722 11:66714933-66714955 GTCTCCTGTGGACCAACCTGTGG + Intronic
1087602727 11:100337424-100337446 CCTCCCTGTGGCCCAAAATCAGG + Intronic
1092269499 12:7012000-7012022 GTTCCCTTTGGACCAAAGTCAGG - Intronic
1093410889 12:18865390-18865412 GTCCACTGTGGAGCAAACCCTGG - Intergenic
1099995137 12:89770155-89770177 GGTCCCTGTGGACTAAACTATGG + Intergenic
1105242131 13:18618407-18618429 GTTTACTGTGGACCAAACACTGG + Intergenic
1108359761 13:49658350-49658372 CTTCCCCATGGGCCAAACTCAGG - Intergenic
1109322226 13:60825211-60825233 ATTTACTGTGGACCAATCTCTGG + Intergenic
1109335711 13:60991054-60991076 CTCCCCTGTGGACCAAAGGCTGG + Intergenic
1110011827 13:70345513-70345535 GGTCCCTGTAGCACAAACTCAGG + Intergenic
1114065721 14:19058617-19058639 GTTTACTGTGGACCAAACACTGG + Intergenic
1114096540 14:19341383-19341405 GTTTACTGTGGACCAAACACTGG - Intergenic
1116093202 14:40335108-40335130 GTTACCTGTGACACAAACTCAGG + Intergenic
1117211135 14:53501382-53501404 CTTTCCTGTGACCCAAACTCAGG - Intergenic
1118547338 14:66906145-66906167 GTTCCCTGGGCACGAAACACTGG - Intronic
1121437745 14:93930065-93930087 GGTCCCTGTGGACAAAACAGGGG + Intergenic
1121739914 14:96244197-96244219 GTACCCCAGGGACCAAACTCGGG - Intronic
1123193157 14:106591005-106591027 TTTCCCTGTGGTCAAAATTCCGG - Intergenic
1123489184 15:20766191-20766213 GTTTACTGTGGACCAAACACTGG - Intergenic
1123545683 15:21335278-21335300 GTTTACTGTGGACCAAACACTGG - Intergenic
1124077808 15:26462276-26462298 GTTCTCTGTGCACCACAGTCAGG - Intergenic
1124888008 15:33704942-33704964 CTTTCCTGTGAACCAAACTTGGG - Intronic
1202954027 15_KI270727v1_random:62548-62570 GTTTACTGTGGACCAAACACTGG - Intergenic
1136615848 16:31397931-31397953 GTTCCCTGTGGAGCACATGCTGG + Intronic
1137754936 16:50893724-50893746 GTTTCCTGTGGACAAAATACAGG - Intergenic
1138549585 16:57740221-57740243 GTTCCCTGTGGGCCCAAACCTGG - Intronic
1139437194 16:66943120-66943142 TTTCCCTGTAGACCAGGCTCTGG - Intronic
1140287865 16:73621605-73621627 GCTCCCTGTGGTTCAAACTTTGG - Intergenic
1153049068 18:884080-884102 GTTCCCTGCAGACTAAACTGTGG - Intergenic
1153107206 18:1541535-1541557 GTTCCCTGTTGCCCAGGCTCTGG + Intergenic
1154446820 18:14441473-14441495 GTTTACCGTGGACCAAACACTGG - Intergenic
1155638053 18:27978680-27978702 GGTCTCTGTGGCCCAGACTCTGG + Intronic
1158137417 18:54223438-54223460 GTTCCCTGGGGAGCAAATTTTGG + Intronic
1159882571 18:73873067-73873089 GTTCCCTGTGCCCCAAGCCCGGG + Intergenic
1164418214 19:28063623-28063645 GTGCCCTGTGGACCTGACTCTGG + Intergenic
1164629003 19:29749006-29749028 GTCCCCCATGGACCAAGCTCTGG + Intergenic
925022961 2:586606-586628 GTTTACTGTGGAGCAAACACTGG + Intergenic
925751294 2:7092014-7092036 CATCCCTGTGGACAGAACTCAGG - Intergenic
926552362 2:14315968-14315990 GTTGCCTGTGGACAAAATCCAGG + Intergenic
928009795 2:27596438-27596460 GGTCCCTGTGGACCAGAGTTGGG - Intronic
931464297 2:62473338-62473360 GCTCCCTGTGGGCCAAGCTGAGG + Intergenic
932267701 2:70382616-70382638 GTTGCCTGTGGAGCAGCCTCTGG + Intergenic
934913556 2:98279827-98279849 GTTCCCTGGGGGCCAGCCTCTGG + Intronic
935925543 2:108064910-108064932 GTTCCCTCTGGACTAACCTCAGG - Intergenic
937219903 2:120336773-120336795 GCTCCCTGTGGACCTGAATCAGG + Intergenic
939888732 2:147710132-147710154 GTTCCCTGGGAAGCAGACTCTGG - Intergenic
939969431 2:148644026-148644048 GTTCCCTGTCACCCAAACTTCGG - Intergenic
944431537 2:199638967-199638989 GTTCCCTGTTCACCAAATCCCGG + Intergenic
946326454 2:218986914-218986936 GTTCCCTGTGGACCAAACTCAGG + Intergenic
1169421570 20:5465002-5465024 CTTCCCTGTTCACCAAACTGTGG + Intergenic
1170116971 20:12871007-12871029 ATTCCCAGTGGACCACACACTGG - Intergenic
1171025653 20:21628409-21628431 GTTTCCTGAGGAAGAAACTCAGG - Intergenic
1173327011 20:42043113-42043135 GTGTTCTGTGGACCACACTCTGG - Intergenic
1175479946 20:59303599-59303621 GTTGCCTGTTTACCAAACCCCGG + Intronic
1176449156 21:6848367-6848389 GTTTACTGTGGACCAAACACTGG + Intergenic
1176827324 21:13713391-13713413 GTTTACTGTGGACCAAACACTGG + Intergenic
1180484202 22:15781209-15781231 GTTTACTGTGGACCAAACACTGG + Intergenic
1184953132 22:47860379-47860401 GTTCCCTGCAGATCAAACACTGG + Intergenic
952967951 3:38632627-38632649 ATGCTCTGTGGCCCAAACTCAGG + Intronic
953913345 3:46903810-46903832 GCTTCCTGTGGCCCAAACTGGGG + Intergenic
960321183 3:116238533-116238555 TTTCCCTGTGGCCCCAACTTGGG + Intronic
961445415 3:126978757-126978779 GATCCCTGTGGACCACAGTGTGG + Intergenic
963499342 3:146105698-146105720 GTTCCCTGAAAACCAAAATCTGG - Intronic
968323390 3:197791360-197791382 GTTCACTGCGGCCCAAGCTCCGG + Exonic
980848054 4:138348011-138348033 GTTAACTGTGGACCACACCCAGG + Intergenic
984560982 4:181269816-181269838 TTCCCCTGTGGACCACACTGTGG - Intergenic
990886141 5:60595532-60595554 GTTCACTGTAAACAAAACTCAGG + Intergenic
991357300 5:65782210-65782232 ATTCCCTGTGGGCAAAACTGGGG - Intronic
997200469 5:132007065-132007087 GTACCCTGTGTGCCCAACTCTGG + Intronic
997425185 5:133798324-133798346 CTTCCCAGAGGAGCAAACTCAGG + Intergenic
998308246 5:141100840-141100862 GTTCCCTTTGGACACAACTTGGG - Exonic
998840428 5:146248073-146248095 GTTCCCTTTGGAAAAAACTAGGG - Intronic
998865369 5:146494742-146494764 TTTCCCGTTGGAACAAACTCTGG - Intronic
999098881 5:149005790-149005812 GTTCCCTGGGGGCCAAACACAGG + Intronic
999257667 5:150218724-150218746 GTTCCCTCTAGACCATACTCCGG - Intronic
999808202 5:155103397-155103419 GTTCTTTGTGGAACAAAGTCAGG + Intergenic
1000566367 5:162852315-162852337 TTTCCATGTTGACTAAACTCAGG - Intergenic
1002022131 5:176370411-176370433 ATTTCCTGTGGCCTAAACTCAGG + Intronic
1003062511 6:2874663-2874685 CTCCCCTGGGGACCCAACTCTGG + Intergenic
1007334897 6:41148781-41148803 GTTTCCTTTGGTCTAAACTCTGG - Intergenic
1008385470 6:50884478-50884500 GTTCTCTGGGAATCAAACTCAGG + Intergenic
1010012816 6:71068964-71068986 GGTCCCAGTGCACCAAAGTCAGG - Intergenic
1010324701 6:74550846-74550868 GATCCCCGTGGTCCAAACTCGGG - Intergenic
1015357230 6:132292801-132292823 GTTCCCAAAGGAACAAACTCTGG - Intergenic
1018014517 6:159699888-159699910 GTTCTCAGTGGACCACAATCTGG - Intronic
1025744382 7:64230153-64230175 TTCCCCTGTGGGCCACACTCAGG + Intronic
1025785172 7:64637359-64637381 GTACCCTGTGGGCAAAACCCAGG + Intergenic
1026640196 7:72117585-72117607 GGTCCCTTTGGCCCAAACTGGGG + Intronic
1027515980 7:79142346-79142368 GTTTAATGTGAACCAAACTCAGG - Intronic
1028103967 7:86855507-86855529 GCTCCTTGGGGACCAAAATCTGG - Intronic
1028942332 7:96536318-96536340 GTTCTCTGTGGCCCAAAATGTGG + Intronic
1030272370 7:107684458-107684480 GTTCCCTGTAGAATAAGCTCTGG - Intronic
1032584787 7:133136234-133136256 GCTCCCTGTGGATCAATCACTGG - Intergenic
1033548654 7:142425523-142425545 GTTGCCTGTGCACCCAAGTCTGG + Intergenic
1034249654 7:149677905-149677927 GTTCCCTGTGGACCAAATTGTGG + Intergenic
1034393331 7:150801963-150801985 CTTTCCTCTGGGCCAAACTCAGG + Intronic
1034512030 7:151543427-151543449 GTTCCTGGTGTACCAAACACTGG + Intergenic
1046509150 8:115177197-115177219 GTTCCTTCTGGCCCAAACTAGGG - Intergenic
1048883394 8:138888462-138888484 GTTCCCTAAGTACCACACTCTGG - Intronic
1048918752 8:139208806-139208828 GTTGGCTGTGGAACAACCTCTGG + Intergenic
1052509632 9:29398979-29399001 GGTGCCTGTGGAACAAATTCTGG - Intergenic
1056925330 9:90829411-90829433 GTGCCCTGAAGACCACACTCAGG + Intronic
1057132629 9:92664670-92664692 GTTCCCTGTGGCCCTCACTGTGG - Intronic
1058995759 9:110297395-110297417 TTTCACTGTGGACCAACTTCTGG - Intergenic
1061625044 9:131836629-131836651 GTTCCCTTTGGAGGTAACTCTGG + Intergenic
1062502803 9:136858512-136858534 GCCCCCTGTGGACCACACCCTGG + Exonic
1062650579 9:137574760-137574782 TTTCCCAGTGGACCAATCTAGGG + Exonic
1203520032 Un_GL000213v1:36149-36171 GTTTACTGTGGACCAAACACTGG - Intergenic
1185515493 X:696202-696224 GTTCCCTGTGGGGCCCACTCTGG + Intergenic
1189501410 X:41563230-41563252 GTTGCCTGTAGTCCTAACTCAGG + Intronic
1189792689 X:44618937-44618959 GTTTCCTGGGGAGCAACCTCTGG - Intergenic
1196432082 X:115637711-115637733 ATTCCCTGTGTACCAACATCTGG - Intronic
1196967732 X:121076800-121076822 ATTCCCTGTGGACTTATCTCAGG + Intergenic
1197055416 X:122113327-122113349 GCTTCCTGAGAACCAAACTCTGG + Intergenic
1200070769 X:153527945-153527967 GTCCCCTGGGGACCAGCCTCAGG + Intronic
1200870264 Y:8090226-8090248 GTGCCCTGTGGGCCAGACCCCGG + Intergenic
1202261034 Y:22970599-22970621 GTTCCCTGTGGGCAAGACACTGG - Intergenic
1202262045 Y:22980288-22980310 GTTCCCTGTGGACAAGACATTGG - Intronic
1202414022 Y:24604340-24604362 GTTCCCTGTGGGCAAGACACTGG - Intergenic
1202415034 Y:24614029-24614051 GTTCCCTGTGGACAAGACATTGG - Intronic
1202455752 Y:25056057-25056079 GTTCCCTGTGGACAAGACATTGG + Intronic
1202456762 Y:25065746-25065768 GTTCCCTGTGGGCAAGACACTGG + Intergenic