ID: 946326549

View in Genome Browser
Species Human (GRCh38)
Location 2:218987396-218987418
Sequence CAGCGCTCAGCAGGGTAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 195}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946326549_946326560 25 Left 946326549 2:218987396-218987418 CCTTCCTACCCTGCTGAGCGCTG 0: 1
1: 0
2: 0
3: 15
4: 195
Right 946326560 2:218987444-218987466 AGCCTGCCCAGAATGAATGGAGG 0: 1
1: 0
2: 2
3: 11
4: 151
946326549_946326558 22 Left 946326549 2:218987396-218987418 CCTTCCTACCCTGCTGAGCGCTG 0: 1
1: 0
2: 0
3: 15
4: 195
Right 946326558 2:218987441-218987463 GCCAGCCTGCCCAGAATGAATGG 0: 1
1: 0
2: 0
3: 23
4: 210
946326549_946326555 0 Left 946326549 2:218987396-218987418 CCTTCCTACCCTGCTGAGCGCTG 0: 1
1: 0
2: 0
3: 15
4: 195
Right 946326555 2:218987419-218987441 GTCCCATGTGGTTCTGCAGATGG 0: 1
1: 0
2: 0
3: 13
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946326549 Original CRISPR CAGCGCTCAGCAGGGTAGGA AGG (reversed) Intergenic
900348712 1:2224755-2224777 CAGCGCGGAGTAGGGTGGGATGG - Intergenic
900631942 1:3641193-3641215 GAGCACTCAGGAGGGAAGGAAGG + Intronic
902812784 1:18898442-18898464 CAGGGCCCAGCAGTGAAGGATGG - Intronic
905229790 1:36507895-36507917 CAGTGCTCAGCAGGTTCGAAGGG - Intergenic
905825790 1:41025107-41025129 CAGCCCTCTTCAGGGGAGGAGGG - Intergenic
905957890 1:42014361-42014383 CAGCACACAGCAAGGAAGGAGGG + Intronic
906197874 1:43940257-43940279 CAGCGCTGAGAATGGTTGGAGGG - Intergenic
912585547 1:110761554-110761576 CAGTGCTCAGTGGAGTAGGAGGG + Intergenic
915067584 1:153239373-153239395 CAGAGCTCAGCAGGGCAGTTTGG - Intergenic
915341413 1:155178763-155178785 CAGCGCTGAGCGCGGTAGGACGG - Intronic
915495578 1:156280425-156280447 CAGCACCCAGCAGAGTAGGTGGG + Intronic
915552516 1:156643488-156643510 CAGCACTCAGCAGGGTCAGCAGG - Intronic
916860207 1:168795377-168795399 CAGAGCACAGGAGGGAAGGACGG + Intergenic
919422644 1:197389902-197389924 CAGCACGCAGCAGGGTGGCAGGG - Intronic
922505136 1:226121860-226121882 CAGCGCTGAGCAGGGGCGGGCGG + Intergenic
922617832 1:226973620-226973642 CAGCCCCCAGCATGGCAGGAAGG - Intronic
922683933 1:227624877-227624899 CAGCGATCAGCAGTGGTGGACGG + Intronic
924624841 1:245689120-245689142 TGGCGCTCAGCAGGGTGGAAAGG + Intronic
1062967147 10:1616474-1616496 CAGAGCTCAGCAGGGTGGTGTGG - Intronic
1062967175 10:1616658-1616680 CAGAGCTCAGCAGGGTGGTGCGG - Intronic
1062967189 10:1616750-1616772 CAGAGCTCAGCAGGGCAGTGTGG - Intronic
1062967285 10:1617403-1617425 CAGAGCTCAGCAGGGTGGTGCGG - Intronic
1062967334 10:1617771-1617793 CAGAGCTCAGCAGGGTGGTGTGG - Intronic
1063461208 10:6216000-6216022 CAGCGCTAAGCAGTGTAGAATGG + Intronic
1064152309 10:12875075-12875097 CAGGGCTTAGCAGGGAAGGTGGG + Intergenic
1066454904 10:35564583-35564605 CAGCGTTCAGCAGAGTTGGCAGG + Intronic
1067025882 10:42843829-42843851 CAGCAGTCAGCAGGGTTGGGTGG - Intergenic
1067358041 10:45549410-45549432 CTGGGCTCAGCAGGGAAGGCAGG + Intronic
1067674627 10:48361670-48361692 CAACGGTCATCAGGGTAGAAAGG - Intronic
1067693668 10:48520372-48520394 CAGCCCTCAGCAGCCCAGGAGGG + Intronic
1068419622 10:56773302-56773324 CAGACCCCAGCAGGGAAGGAGGG - Intergenic
1073455039 10:103631633-103631655 CAGACCTCAGGAGGGAAGGACGG + Intronic
1074541963 10:114372393-114372415 CAGGGCTGGGCCGGGTAGGAGGG + Intronic
1076536001 10:131178127-131178149 GAGCGCTCAGCAGGGAGGCAGGG - Intronic
1077069663 11:662863-662885 CAGCCCTCAGCACGGCAGCAGGG + Intronic
1078692370 11:13595094-13595116 CAATGCTCAGTAAGGTAGGAAGG + Intergenic
1078748024 11:14133905-14133927 CTGCCCTCAGCAGGCCAGGAAGG + Intronic
1082809831 11:57473134-57473156 CAGAGCTCATCAGTCTAGGATGG - Intronic
1083511068 11:63209860-63209882 CAGCTCTCAGCTGGTTAGAAGGG + Intronic
1084063169 11:66688751-66688773 CAGCGCTGAGCTGGGTTGCACGG - Exonic
1084954179 11:72682840-72682862 CAGAACTCTGCAGGGTAGGAAGG + Intergenic
1085119304 11:73957119-73957141 CGGAGCGCAGCAGGGCAGGAAGG - Intronic
1085276150 11:75301588-75301610 CATGGCTCAGCTGGGTAGGGTGG + Intronic
1085900977 11:80699570-80699592 CAGTGCTCAGCAGTGGTGGACGG + Intergenic
1089223227 11:116893282-116893304 CAGGGGTCAGCAGGGGAGGGAGG + Intronic
1089633129 11:119795925-119795947 CAGAGCTCATGAGGGGAGGAAGG - Intergenic
1091453417 12:587633-587655 CAGCGCTGGGCAGGGTGAGATGG - Intronic
1091662030 12:2391465-2391487 CAGCAGTCAGCAGGGTGGGAGGG + Intronic
1093053557 12:14532412-14532434 CAGCATGCAGCAGGGGAGGACGG - Intronic
1094809720 12:34125398-34125420 CAGCTCTCAGCTGGTTAGAAGGG - Intergenic
1096460110 12:51817674-51817696 CAGAGCTCAGAACGGCAGGAAGG + Intergenic
1096677554 12:53233767-53233789 CAGCTCTCAGCAGTGTGGGAGGG + Intergenic
1097733030 12:63151023-63151045 CAGCTCTCAGCAGGGTGAGCTGG + Intergenic
1099954818 12:89343442-89343464 CAGGGCTCAGCAGGGGAGGCTGG - Intergenic
1101578580 12:106020824-106020846 CTGCGCTCTGCAGCGTAGGGAGG + Intergenic
1103207986 12:119145342-119145364 CAGCGCTCAGCAGTGTCCAACGG + Intronic
1103703560 12:122859948-122859970 CAGGGCTCAGCAGGTGGGGAGGG - Intronic
1105893507 13:24699012-24699034 CAGCACCAAGCAGGGTGGGATGG + Intronic
1114497546 14:23143415-23143437 CAGCCCTCAGCAGGGCATGCTGG - Intronic
1114658511 14:24330333-24330355 TAGAGGTCAGAAGGGTAGGAGGG + Intronic
1117460821 14:55943000-55943022 GAGTGCTGAGCAGGGAAGGAGGG - Intergenic
1118282525 14:64442581-64442603 CAGCGCTCAGCATTTTAAGAGGG + Intronic
1119208570 14:72812639-72812661 CAGGGCTCAGCAGGGCATGGAGG + Intronic
1119663706 14:76469037-76469059 CAGAGCACAGAAGGGCAGGAGGG - Intronic
1120950954 14:90041455-90041477 CAGCACCCAGCAGGATAGGTAGG - Intronic
1122349441 14:101078907-101078929 CAGTGCCCAGCAGGGGAGGTGGG - Intergenic
1123426500 15:20175160-20175182 CAGCAGTCAGCAGGGTTGGGTGG - Intergenic
1123535731 15:21181687-21181709 CAGCAGTCAGCAGGGTTGGGTGG - Intergenic
1125785073 15:42309280-42309302 CAGTGCTTAGCAGGGGAAGATGG - Intronic
1130931775 15:88433791-88433813 CTGAGCGCAGCAGGGTAGCAGGG - Intergenic
1132390368 15:101434263-101434285 CAGGGCTCAGCCTGGCAGGAGGG - Intronic
1132653416 16:1031579-1031601 CAGGGCTCAGCAGGGCAGGGAGG + Intergenic
1136734406 16:32451160-32451182 CACCACTCAGAAGGGGAGGAGGG + Intergenic
1137591606 16:49697141-49697163 CAGCCCTCACCAAGGTGGGATGG + Intronic
1138288483 16:55828145-55828167 CATCACTCCCCAGGGTAGGAAGG - Intronic
1138560029 16:57795731-57795753 CAGGGCTGAACAGGGTGGGATGG + Intronic
1138603375 16:58071183-58071205 CACCGCTCAGCCAGGTGGGATGG - Intergenic
1139232847 16:65303113-65303135 CAGGGGTTAGCAGGGAAGGAAGG + Intergenic
1139964276 16:70736935-70736957 CAGTGCTCAGCAGGACAGGGTGG + Intronic
1140773356 16:78226813-78226835 CAGCCCTCAGCAGGTAGGGAAGG - Intronic
1141590933 16:85068096-85068118 CAGAGCTCAGCCGGGTACGGTGG - Intronic
1141781011 16:86161062-86161084 CAGAGCCCAGCAAGGGAGGAAGG - Intergenic
1203018674 16_KI270728v1_random:378442-378464 CACCACTCAGAAGGGGAGGAGGG - Intergenic
1203037009 16_KI270728v1_random:651600-651622 CACCACTCAGAAGGGGAGGAGGG - Intergenic
1143527859 17:7482815-7482837 CAGCGCACACCAGGGCAGGGTGG - Exonic
1143982876 17:10885075-10885097 CAGCCCTGAGCAGGTGAGGATGG - Intergenic
1146730898 17:35193455-35193477 CAGCGCACACCAGGGCAGGGTGG + Exonic
1147154461 17:38536672-38536694 CAGGGCTTAGCAAGGAAGGAGGG - Intronic
1149391361 17:56194580-56194602 CAGTGGTTAGCAGGGTGGGAAGG + Intronic
1151593847 17:75064829-75064851 CTGCTCTGAGCCGGGTAGGATGG + Exonic
1151595999 17:75078315-75078337 CAGCACTCAGCAGGGTGGAGGGG - Intergenic
1152391776 17:80007833-80007855 CATCGCTCAGCAGGGCCAGATGG + Intronic
1152575638 17:81139684-81139706 CAGGGGTCACCAGGGTTGGAGGG - Intronic
1158083755 18:53625936-53625958 CAGCTCTCAGCAGAGAAGGGAGG - Intergenic
1160323687 18:77920087-77920109 CGGGGCTCAGCAGGGAAGGTGGG + Intergenic
1162013558 19:7831596-7831618 AAGGGCACAGCAGGGAAGGATGG - Intronic
1162283765 19:9722006-9722028 CTGAGCACAGCAGGGCAGGAGGG - Intergenic
1164011219 19:21204864-21204886 CAGCTCTCAGCTGGTTAGAAGGG - Intergenic
1164498711 19:28793683-28793705 CCGCGCTCCGCAGCGTGGGAAGG + Intergenic
1167321394 19:48799211-48799233 CTCAGCTCAGCAGGGCAGGAAGG - Intronic
1168350127 19:55670862-55670884 CAGGGCTCAGCAGGGAAGCCAGG - Intronic
925104353 2:1277784-1277806 CAGGGCTATGCAGGGGAGGAGGG + Intronic
925251119 2:2439592-2439614 CAGGGGTCAGCAGGGTAGGGAGG + Intergenic
925401310 2:3575337-3575359 CGGCGCTCGGCAAGGTAGGTTGG + Exonic
926094128 2:10070119-10070141 GAACGCTCAGCAGGTGAGGAGGG + Intronic
926114611 2:10204529-10204551 CAGCGCTGAGCAGGGCTGGCGGG - Intronic
928389409 2:30897687-30897709 CAGGGCTCAGCAGAGGAGGCCGG + Intergenic
930681316 2:54259467-54259489 GAGAGACCAGCAGGGTAGGAAGG + Intronic
933383766 2:81583931-81583953 CAGCTCTCAGCAGAGAAGGTTGG - Intergenic
933701127 2:85256086-85256108 CATGGCTCAGGAGGGGAGGAGGG + Intronic
933769403 2:85733691-85733713 TAGGGCTCAGCAGGGCAGAAGGG - Intergenic
935113019 2:100109059-100109081 CAGAGCTCGGCAGGGTCAGAGGG + Intronic
935718877 2:105962011-105962033 CAGCGCTCAGAATGAAAGGAAGG - Intergenic
936122616 2:109760054-109760076 CAGAGCTCGGCAGGGTCAGAGGG - Intergenic
936222078 2:110611418-110611440 CAGAGCTCGGCAGGGTCAGAGGG + Intergenic
938047868 2:128139560-128139582 CAGCACTCAGCAGGGAAAGCTGG + Intronic
939596860 2:144136211-144136233 CAGCTATCAGTAGGGTAAGATGG + Intronic
940979205 2:159982586-159982608 CAGCATTCTGCAGGGGAGGAAGG - Intronic
946326549 2:218987396-218987418 CAGCGCTCAGCAGGGTAGGAAGG - Intergenic
947740091 2:232480983-232481005 CAGAGCTCAGCAGGGTGGGCAGG + Intronic
947872018 2:233444543-233444565 CAGCGCACAGCAGGCATGGATGG - Intronic
947930205 2:233958697-233958719 CAGAGCTCAGCAGGGGAAGAGGG - Intronic
1169816123 20:9658372-9658394 CATCTTTCAGCAGGGTAGCATGG + Intronic
1172284472 20:33731461-33731483 CAGAGTTGAGCAGGGTAGTAGGG + Intergenic
1173190709 20:40873577-40873599 GATCTCTCAGCAGGGTAGGCAGG + Intergenic
1173667520 20:44773570-44773592 CAGCGCTCAGCAGAGAGGGAGGG - Intronic
1175850366 20:62087425-62087447 CTGGTCTCAGCAGGGTTGGATGG - Intergenic
1176307634 21:5132465-5132487 CAGAGCTCTGTAGGGGAGGAGGG - Intronic
1178675557 21:34628638-34628660 CAGCTCTAAGCAAGGAAGGATGG + Intergenic
1179849426 21:44129565-44129587 CAGAGCTCTGTAGGGGAGGAGGG + Intronic
1179979112 21:44887331-44887353 CAGAGCTCAGCAGGTGAGGCCGG + Intronic
1180234808 21:46451722-46451744 CAGCGCTCTGCCAGGCAGGAGGG + Intergenic
1180538086 22:16414197-16414219 CACCACTCAGAAGGGGAGGAGGG - Intergenic
1181023110 22:20113658-20113680 GTGCCCTCAGCAGGGCAGGAGGG + Intronic
1181433739 22:22898441-22898463 CATCCCTCAGAAGGGAAGGAAGG + Intergenic
1181434680 22:22903810-22903832 CATCCCTCAGAAGGGAAGGAAGG + Intergenic
1182622049 22:31623699-31623721 GACCGCTCAGCCGGGTGGGATGG - Exonic
1183347050 22:37313662-37313684 CAGAGCTCAGGAGGGTGGGTGGG + Exonic
1184596446 22:45516979-45517001 CCGTTCTCAGCAGGGGAGGAGGG - Intronic
1184656421 22:45944201-45944223 CAGGGCTCCGCTGGGGAGGATGG + Intronic
952156000 3:30644266-30644288 CACCGCTCAGCTGGGCAGGGAGG - Intronic
953787333 3:45921143-45921165 CAGAACTCAGCAGTGTTGGAGGG - Exonic
954314287 3:49792816-49792838 GGGCCCTCAGCAGGGTGGGAAGG - Intronic
962436349 3:135370699-135370721 CAGCGCTGAGGAGGGGAAGAGGG - Intergenic
967976715 3:195039580-195039602 CAGGGCTTGGCAGTGTAGGAGGG + Intergenic
971076770 4:23158374-23158396 CAGCGTACAGCAGGGGTGGATGG - Intergenic
974842652 4:67316203-67316225 TTGTGGTCAGCAGGGTAGGAAGG - Intergenic
975658566 4:76665899-76665921 CAGCGCTTATCAGGGAATGAAGG - Intronic
976106814 4:81627787-81627809 CTCAGCTCAGCAGGGAAGGAAGG - Intronic
976795803 4:88931117-88931139 CAGCTCACAGCAGGGTGGCAGGG + Intronic
977944487 4:102896224-102896246 CACCACTCAGAAGGGGAGGAGGG - Intronic
979370740 4:119882797-119882819 CTGTGCTCAACAGGGTAGTAGGG - Intergenic
985779026 5:1860204-1860226 CAGAGCTCAGCAGGCCCGGAAGG - Intergenic
986056180 5:4139084-4139106 CAGTGGTCATCAGGGCAGGAGGG - Intergenic
988722524 5:33892419-33892441 CAGCGCTGAGCGCGGAAGGATGG - Intergenic
993634954 5:90332085-90332107 CAGCCTTCAGCAGGGCAGCAGGG + Intergenic
994336345 5:98570898-98570920 CAGTGCACAGCTGGGAAGGAAGG - Intergenic
997756053 5:136400378-136400400 TAACGCTCAGCATGGCAGGAGGG + Intergenic
1000982187 5:167827868-167827890 CAGGGCACAGCAGGGGAAGAGGG - Intronic
1005503614 6:26451147-26451169 CAGCCCACAGCAGGGCATGAAGG - Intronic
1007852099 6:44813024-44813046 CAGAGCTCACCAGGGTTGAAGGG + Intronic
1010029405 6:71257539-71257561 CAGCACTCAGCAGGGCAGAGAGG + Intergenic
1015762564 6:136680871-136680893 AAGAGCTCTGCAGGGGAGGAAGG + Intronic
1019233037 6:170584607-170584629 CAGCCCACAGCTGGGTCGGAAGG + Exonic
1019659952 7:2218618-2218640 TAGCCCTCAGCAGGGTACGGCGG + Intronic
1019916464 7:4136110-4136132 CAGCGTTCAGCACGGTTGGAGGG - Intronic
1019925088 7:4186544-4186566 CAGGGCTCAGCAGGTGGGGAAGG - Intronic
1021340593 7:19458456-19458478 CAGCCCACAGCAGGGTGGCAGGG + Intergenic
1023868477 7:44250130-44250152 CTGCACCCAGCAGGGTAGGTGGG + Intronic
1026978433 7:74512819-74512841 CAGCGCTGAGCACTGTGGGAAGG - Exonic
1027390270 7:77696859-77696881 GAGCGTGCAGCAGCGTAGGAGGG - Exonic
1027504815 7:79003071-79003093 CTGAGCTAAGCAGGGGAGGAAGG - Intronic
1034940414 7:155226869-155226891 CACCGCTCAGCAGAGCAGGCTGG - Intergenic
1035080251 7:156209740-156209762 GAGCGCTCAATAGGGTAGGAAGG - Intergenic
1036737636 8:11331937-11331959 CAGCGCACACCAGGGCAGGGTGG - Exonic
1037570601 8:20154834-20154856 CAGCGCTCAGCCGTGGTGGACGG - Intronic
1037877418 8:22554812-22554834 CAGGGCCCAGCAGGGCGGGAGGG - Intronic
1040303509 8:46200320-46200342 CAGCGAACCGCAGGGTAGGCTGG + Intergenic
1041196939 8:55410206-55410228 CAGCGAGCAGCAGTGGAGGATGG - Intronic
1041215354 8:55595140-55595162 CAGAGCTCAGCAGGGTATATGGG + Intergenic
1043501709 8:80864729-80864751 CAACGCACAGGAGGGTGGGAAGG + Intronic
1044423089 8:92021423-92021445 CAGTGCTCATCAGGGAAGGGTGG - Intronic
1044968943 8:97601163-97601185 TGGTGCTCAGCAGGGTTGGAGGG + Intergenic
1049288268 8:141788281-141788303 GAGAGCTGAGCAGGGAAGGAAGG - Intergenic
1049448121 8:142641035-142641057 CAGCCATCTGCAGGGCAGGAAGG - Intergenic
1049592003 8:143466843-143466865 CAGCTCTGAGCAGGCTGGGAAGG - Intronic
1055332412 9:75197854-75197876 CAGAGCTCTGCAGGGTGGGTGGG + Intergenic
1056943950 9:90977909-90977931 CAGAGCACAGCAGAGCAGGAGGG + Intergenic
1056955090 9:91075036-91075058 CAGAGCCCATCCGGGTAGGAGGG + Intergenic
1057179559 9:93022406-93022428 CAGCGGTCAGCAGGGGTGAAAGG + Intronic
1057701010 9:97363095-97363117 CAGCGCACAGCTGGAGAGGAGGG - Intronic
1059347457 9:113639264-113639286 CACCACTCAGCAAGGAAGGAAGG - Intergenic
1060522636 9:124302335-124302357 CAGGGATCAGCATGGTTGGAAGG + Intronic
1060801848 9:126549963-126549985 CAGCACCCAGCAGGGCAGAAGGG - Intergenic
1060994382 9:127867902-127867924 CTGTGCTCAGCAGGGCAGGGTGG + Exonic
1061048111 9:128178310-128178332 CAGAGCCCAGCAGGGTGGGATGG - Intronic
1061290789 9:129649340-129649362 CAGCCCAGAGCAGGGTGGGAAGG + Intergenic
1061363460 9:130158050-130158072 AAGCGCTCAGGAGAGGAGGAAGG - Intergenic
1061589481 9:131589353-131589375 CAGTGCTCAGCAGGGCAAGTTGG - Intronic
1062277506 9:135737754-135737776 CAGCCCACAGCCAGGTAGGAGGG - Intronic
1062339656 9:136088312-136088334 CTGTACTCAGCAGGGTGGGAGGG + Intronic
1062449817 9:136610749-136610771 CAGCGCTCAGCAGTGGACGGTGG + Intergenic
1185457763 X:319293-319315 CAGCGCGGAACGGGGTAGGACGG - Intergenic
1185504351 X:620221-620243 CAGGCCTCAGCCGGGGAGGAAGG + Intergenic
1191726907 X:64291453-64291475 CAGCACGCAGAAGGGGAGGAAGG - Intronic
1195469934 X:105219806-105219828 GAGCACTAAGCAGGGTAGGACGG + Intronic
1196875003 X:120148750-120148772 CAGCTCTCAGCTGGTTAGAAGGG + Intergenic
1200076719 X:153554833-153554855 CAGGGCTGAGCAGGCGAGGAAGG + Intronic
1201277697 Y:12314100-12314122 CAGCTCTCAGCTGGTTAGAAGGG + Intergenic
1201357586 Y:13113407-13113429 CAGCTCTCAGCTGGTTAGAAGGG + Intergenic
1202099808 Y:21295357-21295379 CTGAGCACAGCAGGGCAGGAGGG - Intergenic