ID: 946326917

View in Genome Browser
Species Human (GRCh38)
Location 2:218989362-218989384
Sequence TGGAGGAAATGGGACAACGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 203}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946326911_946326917 -10 Left 946326911 2:218989349-218989371 CCCCTCCTGCGAATGGAGGAAAT 0: 1
1: 0
2: 1
3: 11
4: 102
Right 946326917 2:218989362-218989384 TGGAGGAAATGGGACAACGCAGG 0: 1
1: 0
2: 1
3: 19
4: 203
946326908_946326917 -1 Left 946326908 2:218989340-218989362 CCACTAACTCCCCTCCTGCGAAT 0: 1
1: 0
2: 0
3: 11
4: 107
Right 946326917 2:218989362-218989384 TGGAGGAAATGGGACAACGCAGG 0: 1
1: 0
2: 1
3: 19
4: 203
946326906_946326917 20 Left 946326906 2:218989319-218989341 CCTGGGAAGCAGTGGGGTTTCCC 0: 1
1: 0
2: 3
3: 27
4: 241
Right 946326917 2:218989362-218989384 TGGAGGAAATGGGACAACGCAGG 0: 1
1: 0
2: 1
3: 19
4: 203
946326907_946326917 0 Left 946326907 2:218989339-218989361 CCCACTAACTCCCCTCCTGCGAA 0: 1
1: 0
2: 0
3: 9
4: 103
Right 946326917 2:218989362-218989384 TGGAGGAAATGGGACAACGCAGG 0: 1
1: 0
2: 1
3: 19
4: 203
946326905_946326917 21 Left 946326905 2:218989318-218989340 CCCTGGGAAGCAGTGGGGTTTCC 0: 1
1: 0
2: 1
3: 23
4: 203
Right 946326917 2:218989362-218989384 TGGAGGAAATGGGACAACGCAGG 0: 1
1: 0
2: 1
3: 19
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946326917 Original CRISPR TGGAGGAAATGGGACAACGC AGG Intergenic
901055580 1:6447426-6447448 TGCAGGAAATGCGACACCGCAGG - Intronic
902397179 1:16138792-16138814 TGGAGGAAAGGGGATGAGGCCGG - Intronic
902478810 1:16701211-16701233 TGCAGGAAACGCGACACCGCAGG + Intergenic
902830134 1:19007275-19007297 AGGACGAAATGGGATAATGCAGG - Intergenic
904237257 1:29123592-29123614 TGGAGGTAGTGGGCCGACGCTGG + Intronic
905163450 1:36058788-36058810 TGGAGGAGATGGGAGAAGGCTGG - Exonic
906236446 1:44214017-44214039 GGGAGGAGATGGGACATCGTGGG + Intronic
909182237 1:72439381-72439403 TGGAGGAAAGGAGACAAGTCTGG - Intergenic
911002330 1:93179814-93179836 CGGAGGAAAGGGGAGAAGGCGGG + Intronic
911047592 1:93641276-93641298 GGGAGGAAATGGCAGAACTCTGG + Intronic
911670040 1:100597579-100597601 TGGAGGAAAAGGGACACCAAAGG - Intergenic
914718203 1:150268617-150268639 TGGAGGAACTGGGGCAAGCCTGG - Exonic
915345268 1:155193885-155193907 TGGAGGAAATGGAGCTAAGCGGG + Intergenic
915574858 1:156768543-156768565 AGGAGGAAAGGGGAAAAAGCCGG - Intronic
916498163 1:165364108-165364130 AGAAGGAAATGGGGCAACACAGG + Intergenic
916828861 1:168470610-168470632 TGGAGGAAATGGGACATAAGGGG - Intergenic
917503151 1:175604169-175604191 AGGAGGAGATGGGCCAAGGCAGG + Intronic
917647303 1:177041797-177041819 TTGAGGAAATGGGAGAAAGAGGG - Intronic
919686771 1:200490527-200490549 TGAAGGAAATGATACAACGGTGG + Intergenic
920313991 1:205065031-205065053 GGGAGGAAATGGGCCCAGGCCGG - Intronic
920404903 1:205701717-205701739 TGGGGGAAATGGGAGGACCCTGG + Intergenic
920862726 1:209723748-209723770 TAAAGGAAAAGGGACAATGCAGG + Intronic
921029663 1:211326537-211326559 TTGAGCAAATGGGTCAACACAGG + Intergenic
922613234 1:226945193-226945215 ATGAGGAAATGAGAAAACGCAGG + Intronic
923336274 1:232973011-232973033 AGGAGGAAATGGGAAAAAGAAGG + Intronic
923991977 1:239448144-239448166 GGGATTAAATGGGACAACACAGG + Intronic
924551141 1:245078673-245078695 TAGAGGAAATGGGAAAATGTTGG + Intronic
1066206741 10:33196874-33196896 TAGAGGAAATGGGAGAAAGCTGG + Intronic
1067737854 10:48872449-48872471 TAGAGGAAATGAGATAAAGCAGG + Intronic
1067748987 10:48957634-48957656 TGGAGGAAATGGGACTGGTCGGG - Intronic
1067775041 10:49157306-49157328 TGGAGAAAATGAGATAAGGCTGG + Intronic
1069266790 10:66468468-66468490 TGGGGGAAATGGGAAAATGCTGG + Intronic
1071877393 10:89855856-89855878 TGGAGGAGATGGGAGAAGGAAGG + Intergenic
1073128087 10:101164921-101164943 TGGGGGAAATGGGAAAATGTTGG - Intergenic
1073489633 10:103844430-103844452 ATCAGGAAATGGGATAACGCTGG + Intronic
1075005594 10:118827687-118827709 AGGATTAAATGAGACAACGCAGG + Intergenic
1075709177 10:124521569-124521591 TGGCGGAAATGGGAGAATGAAGG + Intronic
1076296944 10:129392901-129392923 TGGAGGGAATGGAATAACGACGG - Intergenic
1083262208 11:61529265-61529287 TGAAGGAAAGGGCACAAAGCAGG - Intronic
1083750929 11:64760160-64760182 TGGAGGAAGTGGGTCAGCACAGG - Exonic
1083958150 11:65998304-65998326 GGGAGGAAATGGGAAATGGCTGG - Exonic
1085059373 11:73430664-73430686 AGGAGGAAATGGGACAGCAGTGG - Intronic
1085620277 11:78032646-78032668 TGGAGGAAAGAGGGCAAGGCTGG - Intronic
1086454351 11:86946720-86946742 TGGAGGAAAAGTGATAACCCAGG + Exonic
1087812157 11:102620461-102620483 GGAGGGAAATGGGACAACTCTGG - Intronic
1089278159 11:117353618-117353640 TGAAGAAAATGGGACAGCCCTGG + Intronic
1091635002 12:2190373-2190395 TGGAGGGAATGGGGCACTGCGGG - Intronic
1093201148 12:16187637-16187659 TGGAGTAAATGGAACACTGCAGG + Intergenic
1093319531 12:17696434-17696456 CGGAATAAATGGGACAACGTTGG - Intergenic
1095976139 12:47942270-47942292 TAGAGGAAATGGGACTTTGCCGG - Intronic
1096879780 12:54658360-54658382 AGGAGGAAACGGGACAAGGGAGG - Intergenic
1096911795 12:54991259-54991281 CAGAGGAAATGGGACAACTGCGG + Intergenic
1098167311 12:67711630-67711652 TGGAGGAATTGGGATAATGATGG + Intergenic
1099003170 12:77205082-77205104 TGGAGGAAATGGGAAATTGTAGG + Intergenic
1099004378 12:77218688-77218710 TAGATGAAATGGGACAAGACTGG - Intergenic
1099241348 12:80142948-80142970 TGGAGGACTTGGGACCACTCAGG + Intergenic
1101133298 12:101711535-101711557 GGGAGGAAATGGGAAGAGGCAGG + Intronic
1101697768 12:107142522-107142544 TGGAGGAAATGGGACCCAGGTGG + Intergenic
1102555011 12:113721005-113721027 TGCTGGAAATGGGTCAACTCTGG - Intergenic
1104167517 12:126248089-126248111 TGGAGGAAATGGGAAAATGTTGG + Intergenic
1105255150 13:18739412-18739434 AGCAGGAAAGGGGACCACGCAGG + Intergenic
1105834111 13:24193343-24193365 TGGAGGAACTGGGAGAACGGAGG + Intronic
1106677980 13:31981944-31981966 TGGAGCAAGAGGGACAAGGCTGG - Intergenic
1106916334 13:34519285-34519307 TGGAGCAAGTGGGAAAAAGCAGG - Intergenic
1107332005 13:39311540-39311562 TGCAGGAAGTGGGACAGTGCTGG + Intergenic
1108598758 13:51972613-51972635 TGGAGGCAATGAGACCACGTAGG - Intronic
1115398311 14:32933578-32933600 AGGAGGAAGTGGGACAACGGGGG + Intergenic
1124049377 15:26180784-26180806 TGGGGGAAATGGGAAAATGTTGG + Intergenic
1125091317 15:35796117-35796139 AGGAGGAATTGGGAAAACACTGG - Intergenic
1125445577 15:39751663-39751685 GGGAGGAAATGGGAAAATGTAGG + Intronic
1125477717 15:40058672-40058694 TGGAGGAATTGGGACAGGGAAGG + Intergenic
1126204480 15:46029568-46029590 TGGAGGAAATGGGAAGATGTTGG - Intergenic
1127396815 15:58549829-58549851 TGGAGGAGATGGCAGCACGCAGG + Intronic
1127649357 15:60992175-60992197 TGGAGGAAATGGCACAAAGAAGG + Intronic
1128140311 15:65295387-65295409 TAGGGGAAATGGGCCAACGAAGG + Intronic
1129051320 15:72783902-72783924 CGGAGGAGGTGGGACAACGGCGG + Intronic
1129699745 15:77760746-77760768 TGGAGGAACTGGGACACAGGAGG + Intronic
1131938417 15:97533618-97533640 TGGAGGAAATGAGACAAGTTGGG + Intergenic
1133954004 16:10423887-10423909 TGGAGAACATGGAACTACGCTGG - Intronic
1134475789 16:14572489-14572511 TGGAGAAAAAGGGAAAACACTGG + Intronic
1134875994 16:17699219-17699241 TGGATGAAATGTGACACAGCTGG - Intergenic
1135068411 16:19331297-19331319 TGCAGGAAATGGAACAAGGTTGG - Intergenic
1135183020 16:20291738-20291760 TGGAAGAAATGGGACAAGGAGGG - Intergenic
1135342995 16:21664670-21664692 TGGAAGAAATGGAAAAATGCAGG + Intergenic
1135462612 16:22658401-22658423 AGGAGGAATTGGGAAAACACTGG - Intergenic
1137230236 16:46557880-46557902 TGGAGTAAAAGGGACAATGTTGG + Intergenic
1142577696 17:920438-920460 TGGAGGAATTGGGATCAGGCAGG - Intronic
1142710059 17:1718081-1718103 TGGAGTAAATGGGCAAAAGCAGG - Intronic
1143336033 17:6172099-6172121 AGGAGGAAATGGGTCTCCGCGGG - Intergenic
1145840239 17:27988503-27988525 AGGAGGAAATGGGATAATGAAGG + Intergenic
1152332920 17:79684147-79684169 TGGAGGAAGAGGGAGAAGGCAGG + Intergenic
1154407551 18:14108010-14108032 TGAAGGAAAGGATACAACGCTGG + Intronic
1154435872 18:14341190-14341212 AGCAGGAAAGGGGACCACGCAGG - Intergenic
1156490325 18:37492170-37492192 TGGAGGAAGTGGGAGAAAGCTGG + Intronic
1158951384 18:62498649-62498671 AGGAGGAAATAGGACATAGCAGG - Intergenic
1159824727 18:73193248-73193270 TGGATGAAATTGGTCAAAGCAGG + Intronic
1161626551 19:5330363-5330385 AGGAGGAAATGAGAAAACACAGG + Intronic
1162252116 19:9454449-9454471 TGGAGAACATGGAACTACGCTGG + Intergenic
1162308435 19:9890015-9890037 GGGAGGAGAGGGGACAACGAAGG + Intronic
1162343450 19:10106123-10106145 TGGAGGAAATGGGCCGAAGCGGG + Intergenic
1162455144 19:10779397-10779419 TGGTGACAATGGGTCAACGCAGG - Intronic
1163084502 19:14969570-14969592 TGAAGGAAGTGGGACAGGGCTGG - Intronic
1166991489 19:46695506-46695528 TGGAGGAAATGAGGCCACACAGG + Intronic
1202712829 1_KI270714v1_random:27042-27064 TGCAGGAAACGCGACACCGCAGG + Intergenic
925113275 2:1354215-1354237 TGGGGGAAGTGGAAGAACGCCGG + Intronic
925113321 2:1354428-1354450 TGGGGGAAGTGGAAGAACGCCGG + Intronic
926613505 2:14971572-14971594 TGGAAGAAAAGGGAAAACGAAGG - Intergenic
931686160 2:64795975-64795997 TGGATGAAATGCCACACCGCAGG - Intergenic
934658323 2:96129507-96129529 TGGAGTAGATGGGACAATGGTGG + Intronic
935803872 2:106727715-106727737 TGGAGGAGGTGGGACCAGGCAGG + Intergenic
936803181 2:116291292-116291314 TGGAGGAAGGGGGACAAGGCTGG + Intergenic
938657201 2:133446775-133446797 TGGAGGAGATGAGACAACCATGG + Intronic
938894960 2:135741200-135741222 CGGAGGAATTGGTAGAACGCAGG - Intergenic
942167193 2:173253411-173253433 GGGAGGAAAAGGGACAAAACTGG + Intronic
942672217 2:178388376-178388398 TGCAGGCAATGGGCCACCGCAGG - Intronic
944021956 2:195115477-195115499 TGGAGGTAATTGGAAAACGGGGG + Intergenic
945941169 2:215951909-215951931 TGGGGGAAATGGGGAAATGCTGG - Intronic
945943638 2:215973554-215973576 TGGAGCAAATGGATAAACGCAGG + Intronic
946162058 2:217841339-217841361 GGGAGGATATGGGGCAAGGCAGG + Intronic
946326917 2:218989362-218989384 TGGAGGAAATGGGACAACGCAGG + Intergenic
946556999 2:220869675-220869697 TGGAGGAAATGGAAGAAGTCTGG - Intergenic
947532072 2:230915582-230915604 TGGAGTAAATGAGACAATACAGG + Intronic
947619552 2:231580809-231580831 TGGAGGAAGGGGGAGGACGCGGG + Intergenic
948399452 2:237673262-237673284 TGTAGGAGATGGGACAATGCGGG + Intronic
948707360 2:239803359-239803381 TGGAGGCAGAGGGACATCGCGGG - Intergenic
1169780142 20:9301063-9301085 AGGAGGAAATGCGACTACGGAGG - Intronic
1172468210 20:35172599-35172621 TGGAGGGAATGGGAAGACCCTGG + Intronic
1172701890 20:36858608-36858630 TGGAGGAACTGGGAGAATGCAGG - Intronic
1173184558 20:40830691-40830713 TGGAGGAAATGGAGCAACATGGG + Intergenic
1174734826 20:52956068-52956090 TGGAGGAATGGGGACCACACTGG - Intergenic
1175816962 20:61888205-61888227 TGGATGAAATGAGACTCCGCAGG + Intronic
1176416861 21:6481002-6481024 TGGTTGACATGGGACAAAGCAGG - Intergenic
1176841164 21:13844444-13844466 AGCAGGAAAGGGGACCACGCAGG + Intergenic
1178025355 21:28460247-28460269 TGGAGAAAATGGGACCTCACTGG - Intergenic
1179692359 21:43089335-43089357 TGGTTGACATGGGACAAAGCAGG - Intergenic
1180858911 22:19065675-19065697 TGGAGGAAGTGAGAGGACGCTGG - Intronic
1182569518 22:31226064-31226086 TGAGGGATATGGGACAACCCTGG - Intronic
1183786411 22:40031469-40031491 AGGAGGTAAAGGGACAAAGCAGG - Exonic
1184346674 22:43917889-43917911 TGGGGGAAGAGGGACAAGGCAGG - Intergenic
1184779216 22:46637980-46638002 TGGAGGGGATGGGACAAGGTGGG + Intronic
950594218 3:13964699-13964721 TAGCGGAAATGGGACAACCTGGG + Intronic
952674907 3:36016876-36016898 TGGGGGAAATGGGAAGACGTAGG - Intergenic
953797898 3:45999618-45999640 TTGAGAAAATGGGACACCACTGG - Intergenic
957512876 3:81212718-81212740 TGGAGGCAATGAGAAAATGCTGG - Intergenic
959481618 3:106879535-106879557 TGGGGGAAATGGGAAGATGCTGG + Intergenic
961561833 3:127735740-127735762 GGGAGGGAATGGGAGAAGGCGGG - Intronic
961751305 3:129096355-129096377 AGGAGTAAATGGGACAACTCAGG - Intronic
964394684 3:156233282-156233304 TGGAGGATATGGGAGAACAGGGG + Intronic
965757653 3:172041099-172041121 TGGCCGCAATGGGCCAACGCTGG + Intronic
969155999 4:5210388-5210410 TGGACGAAAAGGGACAAAGAAGG - Intronic
972668451 4:41190882-41190904 TTGAAGAAATGGACCAACGCTGG + Intronic
975448704 4:74499895-74499917 TGGGGGAAAGGGGACAGCACTGG + Intergenic
976622901 4:87147248-87147270 TGTAGGAAAGGGGAAAATGCTGG - Intergenic
977738172 4:100443819-100443841 TGGTGGACATGGGACACCACTGG + Intronic
978350606 4:107816948-107816970 GGGAGGAAAAGGGAAAAGGCAGG + Intergenic
978776798 4:112513810-112513832 TGGAGGAAAAGGGAAAAATCAGG - Exonic
982217494 4:153095002-153095024 TGGAGCAAAGGGGACAAGGAAGG - Intergenic
982236676 4:153257494-153257516 TGGAGGAAATGAGAGAAGGCTGG - Intronic
982860779 4:160446343-160446365 TGGAGGAAATGGGAAAATTTTGG - Intergenic
984185939 4:176544041-176544063 TGGATCAAGTGGGATAACGCAGG - Intergenic
985177023 4:187213199-187213221 TGGAGGAAATGAAACGAAGCGGG - Intergenic
985943941 5:3162446-3162468 TGGAGGAAAATGGACAACCTGGG - Intergenic
986456363 5:7924546-7924568 TGCAGGAAATGGGACAACACCGG + Intergenic
990818036 5:59807356-59807378 TGGGGGAAATGGGACCCCACAGG - Intronic
992992060 5:82293949-82293971 TAGAGGAAGTGGGAGAATGCAGG - Intronic
995038223 5:107559224-107559246 TGGAGGCAATGGGACCCAGCAGG - Intronic
1000266885 5:159646655-159646677 TATGGGAAATGGGAAAACGCTGG + Intergenic
1001855553 5:175007557-175007579 TGGAGGAAAAGGGAAAAGGGAGG - Intergenic
1002180591 5:177429187-177429209 AGGATGGAGTGGGACAACGCTGG + Intronic
1003518270 6:6835735-6835757 TGGAGGAAATGGGGAAAACCAGG - Intergenic
1006782581 6:36642261-36642283 TGAAGGAAATTGGAAAACACTGG - Intergenic
1007163363 6:39810761-39810783 TGAAGGAAATAGGAAAAGGCAGG - Intronic
1007969718 6:46038400-46038422 TGGGAGAAAGGGGACAACCCAGG + Intronic
1011040010 6:83019691-83019713 TGAAGGAAATGGGATAAGGCAGG + Intronic
1011335461 6:86254777-86254799 GGGAGGAAATGGTACAGGGCAGG + Intergenic
1012391236 6:98742505-98742527 TGGGGGAAATGGGAAAATGTTGG + Intergenic
1013713942 6:112935114-112935136 AGTAGGAAATGGGAGAAAGCAGG - Intergenic
1016022329 6:139249174-139249196 GGGTGGAAATGGGGCAACACAGG + Intronic
1016585029 6:145674402-145674424 TGGGGGCAATGGAACAAAGCTGG + Intronic
1016599859 6:145846120-145846142 TGGGGGAAAGGGGAGAACACTGG - Intergenic
1020140659 7:5609741-5609763 TGGAGGAAATGGGGCCCAGCTGG - Intergenic
1023776774 7:43615617-43615639 TGGAGTAAATGGCAGAAGGCAGG - Intronic
1024027015 7:45419776-45419798 GGAAGGAATTGGGACAAGGCAGG + Intergenic
1026060781 7:67024020-67024042 TAGAGGAAATGTGACATCACTGG - Intronic
1026717587 7:72803374-72803396 TAGAGGAAATGTGACATCACTGG + Intronic
1027571403 7:79871812-79871834 TGGAGGAAACAGGACAATTCTGG + Intergenic
1028783226 7:94761565-94761587 TGGAGGATAAGAGACAAAGCAGG + Intergenic
1030688711 7:112511335-112511357 AGCATGAAATGAGACAACGCTGG - Intergenic
1031626064 7:123994530-123994552 TGGAGGCCATGTGACAACACTGG + Intergenic
1032978103 7:137249125-137249147 TGGAATAAATGGGACACAGCAGG - Intronic
1033467748 7:141611263-141611285 AGGAGGAGATGGGACACTGCAGG + Exonic
1034800358 7:154052193-154052215 TGGAGGGGCTGGGACCACGCGGG - Intronic
1035712552 8:1729722-1729744 TGGAGGGAATGGCACAGCCCTGG - Intergenic
1035844314 8:2846815-2846837 TGAAGGAAATGGGAAAACTATGG - Intergenic
1036621239 8:10425480-10425502 GGGAGGAAGTGGGTCCACGCAGG - Intronic
1036635111 8:10544783-10544805 AGGAGGAAATAGGACTACGTAGG - Intronic
1037940229 8:22945723-22945745 AGGAGGAAATGGAACAGTGCTGG - Intronic
1039377766 8:37053709-37053731 AGGAGGAAGTGGGAGAAGGCAGG + Intergenic
1039712478 8:40069981-40070003 TGGGGGAAATGGGAAGATGCTGG + Intergenic
1041078003 8:54186762-54186784 TAGAGGAAAAGGAACAACCCTGG + Intergenic
1041140816 8:54817346-54817368 TGGAGGAGATGGGATCAAGCTGG + Intergenic
1041202950 8:55469126-55469148 TGGAGGAATTGGAAAAAGGCAGG - Intronic
1045248427 8:100463256-100463278 TGTTGGAAGTGGGACAACCCAGG - Intergenic
1048748264 8:137640861-137640883 TGGAGCAAAAAGGACAAAGCTGG - Intergenic
1050177437 9:2882829-2882851 TGGAAGAAATTGGACAACAAGGG - Intergenic
1051654827 9:19369442-19369464 AGGAGAAAATGCGACAACTCTGG + Intronic
1051854129 9:21543222-21543244 TGGAGGAAATGAGAAAACTGAGG + Intergenic
1052960255 9:34289524-34289546 TGGAGGAAATGGGAGAATAGAGG - Intronic
1056084379 9:83130838-83130860 TGGAGGAACTAGGACAACCTGGG - Intergenic
1060921187 9:127421713-127421735 TGGAGAAAATGAGCCAAGGCCGG - Intergenic
1190325499 X:49204796-49204818 TGGAGGAAAGGGGAGAGAGCGGG - Intergenic
1190397554 X:50000230-50000252 TGGATGCAATGGGGCAACTCAGG - Intronic
1190774557 X:53542329-53542351 TGGAACAAATGGGAAAACACTGG + Intronic
1191119881 X:56892167-56892189 TGGGGGAAATGGGACAAAGTTGG + Intergenic
1192941020 X:75911928-75911950 TGGAGGAAAGGGGATAACCTTGG - Intergenic
1193005433 X:76613430-76613452 TGGAGCAAATAGAACAAAGCTGG + Intergenic
1193812172 X:86064649-86064671 TGGGGGAAATGGGAAGACGTTGG - Intergenic
1197972618 X:132130964-132130986 AGGAGGAGATGGGACACTGCAGG - Intergenic
1198190560 X:134300019-134300041 TGAAGGAAAGGGGACAAGCCTGG + Intergenic
1198402553 X:136281744-136281766 TGGAGGGAATGGGAGAAAGTGGG - Intergenic
1199074153 X:143510791-143510813 TGGAGGGAATGGGAGAGGGCAGG - Intronic
1199093147 X:143714052-143714074 TGGAGGGAATGGGAGAGGGCAGG - Intronic
1200113548 X:153757939-153757961 TAGGGGAAATGGGAAAATGCTGG + Intergenic
1200179407 X:154141166-154141188 TGGCGGTAATGGGACAAGGCTGG + Intergenic