ID: 946329944

View in Genome Browser
Species Human (GRCh38)
Location 2:219003259-219003281
Sequence CGAAGGCCGGGAGCCTGCGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 107}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946329934_946329944 25 Left 946329934 2:219003211-219003233 CCAGGATGTTCTGGATCATGTTC 0: 1
1: 0
2: 1
3: 13
4: 183
Right 946329944 2:219003259-219003281 CGAAGGCCGGGAGCCTGCGAGGG 0: 1
1: 0
2: 0
3: 9
4: 107
946329933_946329944 28 Left 946329933 2:219003208-219003230 CCACCAGGATGTTCTGGATCATG 0: 1
1: 0
2: 0
3: 15
4: 190
Right 946329944 2:219003259-219003281 CGAAGGCCGGGAGCCTGCGAGGG 0: 1
1: 0
2: 0
3: 9
4: 107
946329939_946329944 -8 Left 946329939 2:219003244-219003266 CCTCCTGCAGGTTGGCGAAGGCC 0: 1
1: 0
2: 3
3: 19
4: 132
Right 946329944 2:219003259-219003281 CGAAGGCCGGGAGCCTGCGAGGG 0: 1
1: 0
2: 0
3: 9
4: 107
946329936_946329944 1 Left 946329936 2:219003235-219003257 CCAGCAGCGCCTCCTGCAGGTTG 0: 1
1: 1
2: 3
3: 36
4: 311
Right 946329944 2:219003259-219003281 CGAAGGCCGGGAGCCTGCGAGGG 0: 1
1: 0
2: 0
3: 9
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946329944 Original CRISPR CGAAGGCCGGGAGCCTGCGA GGG Exonic