ID: 946330718

View in Genome Browser
Species Human (GRCh38)
Location 2:219007589-219007611
Sequence GTGTAGGAAGGTTGTGAAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 180}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946330714_946330718 5 Left 946330714 2:219007561-219007583 CCAAGGTGATTGAGGAGCAAGAA 0: 1
1: 0
2: 0
3: 19
4: 219
Right 946330718 2:219007589-219007611 GTGTAGGAAGGTTGTGAAATTGG 0: 1
1: 0
2: 0
3: 13
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946330718 Original CRISPR GTGTAGGAAGGTTGTGAAAT TGG Intronic
902270824 1:15303392-15303414 GTGCAGGAAAGCTCTGAAATGGG - Intronic
903253152 1:22071696-22071718 GATAAGGAAGATTGTGAAATTGG + Intronic
904578299 1:31520690-31520712 GTGGAGGAAGGTTTAGAAAAAGG + Intergenic
906300508 1:44678118-44678140 GGGAAGGAAGGCTGGGAAATGGG + Intronic
908201593 1:61801490-61801512 ATTTAATAAGGTTGTGAAATGGG + Intronic
911246351 1:95522661-95522683 GTGTAGGAAGGAGGTAAAATGGG + Intergenic
912246858 1:107968675-107968697 GTGAAGGCAAGTTGGGAAATAGG + Intergenic
916348946 1:163826988-163827010 ATGTGGGGAGGTTGGGAAATGGG + Intergenic
916689107 1:167173609-167173631 GTGTGGGCTGGATGTGAAATTGG - Intergenic
917513447 1:175687565-175687587 GTCTAGAAAGGTTTAGAAATGGG - Intronic
917764445 1:178201378-178201400 GTTTAGGAAGATTGTGATACTGG + Intronic
919228833 1:194745488-194745510 GTCTAGGAGGGTTTTGAAAGTGG - Intergenic
919261715 1:195204441-195204463 GTGGAGGAAGGTTGTCAATGAGG + Intergenic
920711709 1:208301615-208301637 GTTTTTGAAGGTTGTGAAACCGG + Intergenic
921037882 1:211399847-211399869 GTAGAGGAAGGTTGAGAAAAAGG - Intergenic
1064748417 10:18500845-18500867 GTAAAAGAAGGCTGTGAAATCGG + Exonic
1064994055 10:21280979-21281001 GTATAGGATGGTAGAGAAATAGG + Intergenic
1065971290 10:30808000-30808022 GTGGAGGAAGGTTCTGGAACTGG + Intergenic
1068558699 10:58487558-58487580 GTATTGGCAGGTGGTGAAATAGG - Intergenic
1069282758 10:66676221-66676243 GTGTAGGCAGGCTGTCAAAATGG + Intronic
1069917699 10:71797569-71797591 GTGTGGGTAGGATGTGAGATGGG + Intronic
1072539398 10:96386841-96386863 GTGTAGGAACGATGGGCAATGGG - Intronic
1073239106 10:102043164-102043186 GAGGGGGATGGTTGTGAAATAGG - Intronic
1073973969 10:109078272-109078294 GTGTTGGAAGGTTTTGTAAATGG - Intergenic
1074227044 10:111494698-111494720 GTGTAGATAAGTTGTTAAATTGG + Intergenic
1075449929 10:122544275-122544297 GCATAGGAAGGCTGTGAAAGAGG + Intergenic
1076000647 10:126910343-126910365 GTGGATGCAGGTAGTGAAATGGG + Intronic
1081465632 11:43313755-43313777 GTGTAGGTCGGTTGTGAAGGAGG + Intronic
1082925941 11:58547477-58547499 GTCTAGGATTGTTGTTAAATTGG - Intronic
1085957754 11:81421030-81421052 GGGTAGGAAGGGTGAGAAAAGGG - Intergenic
1088013025 11:105026183-105026205 GTGTGGGAAGGTTGAGGAAAGGG - Exonic
1088089419 11:106021300-106021322 GTGAAGAACGATTGTGAAATGGG - Exonic
1088318073 11:108527485-108527507 CTTTAGGAAGGTTTTGAAAGCGG - Intronic
1088919858 11:114252856-114252878 GTGTTGGGAGGATGTGAATTGGG + Intergenic
1090304972 11:125683556-125683578 GTGTAGGATAGTTGTATAATAGG - Intergenic
1091021229 11:132101971-132101993 CTGTAGGAATGGTGGGAAATGGG - Intronic
1093797551 12:23331111-23331133 CTATAGGAAGGCTGTGAAATGGG - Intergenic
1094625061 12:32115594-32115616 ATGTGGGAAGGTGGTGAAAATGG + Intronic
1095216393 12:39555349-39555371 GTGGAGGAAGATGGTGGAATAGG + Intronic
1095694098 12:45124862-45124884 CTGTAGGAAGGCTGTCACATTGG + Intergenic
1096212564 12:49777804-49777826 GAGAAGGAAGATTGTGGAATTGG - Intergenic
1097100914 12:56588761-56588783 CTGTAGGAAGGTTGGGGAAGTGG + Intronic
1100225387 12:92551130-92551152 GTGAAGGAAGGTTCTTAAAATGG + Intergenic
1100346365 12:93735253-93735275 GTGTAGGCAGCTTACGAAATGGG + Intronic
1100778972 12:98003330-98003352 AAGTAGGAAGGCTGTGAATTGGG - Intergenic
1101094524 12:101323454-101323476 GTGTTGGAATGGTGTGAAACAGG - Intronic
1101101231 12:101394986-101395008 GTAGAGGAAGCTTGTGAAGTAGG - Exonic
1103364740 12:120373628-120373650 GTGGGGGAAGTTTGTAAAATGGG - Intergenic
1104009527 12:124919858-124919880 GTGTAGGGAGGTCGGGAAATCGG - Intergenic
1104919767 12:132284788-132284810 TTGTGGGAAGGGTGTGAAGTGGG + Intronic
1105261051 13:18779680-18779702 GTATAAGAAGGATATGAAATTGG - Intergenic
1107321480 13:39193762-39193784 GTTTATTAAGGTTGTCAAATAGG + Intergenic
1108310337 13:49183276-49183298 GTTTAGGAAGGCTTTGAAAAGGG - Intronic
1108691228 13:52861096-52861118 GAGTAAGAAGGTGGTGAAATAGG - Intergenic
1109647892 13:65284078-65284100 GTGTAGGAGGGATATGAAAGTGG + Intergenic
1112766583 13:102752126-102752148 GTCTAGGAAGGATGTGCAGTGGG + Intronic
1113147796 13:107228367-107228389 TTATAGGAAAGTAGTGAAATTGG + Intronic
1113458548 13:110465870-110465892 GGGCAGGAAGGCTTTGAAATGGG - Intronic
1114164036 14:20200516-20200538 GTGTCTGAGGATTGTGAAATGGG + Intergenic
1116638945 14:47436295-47436317 GTGTAGCAAGGGTTAGAAATAGG + Intronic
1119272604 14:73322216-73322238 GAGAAGGAGGGTTGTGAAAAGGG + Intronic
1119977264 14:79038951-79038973 GTGTAGGGAGGATGGTAAATTGG + Intronic
1124133680 15:27013763-27013785 TTGTAGTAAGTTTTTGAAATAGG + Intronic
1126330825 15:47529291-47529313 GTGTAAGAAAGTTGAGAAAGTGG + Intronic
1130912047 15:88277499-88277521 GCGTAGGGAGGGTGTGAACTGGG - Intergenic
1131019279 15:89084702-89084724 TTAGAGGAAGGTTCTGAAATGGG + Intergenic
1134362907 16:13549213-13549235 GTGTAGGAGGTTAGGGAAATGGG + Intergenic
1135170747 16:20181298-20181320 GTATAGGAAGGATGGGAGATGGG - Intergenic
1135655497 16:24245037-24245059 AGGTGGGGAGGTTGTGAAATTGG - Intergenic
1138944178 16:61827933-61827955 GTGTAAGAGGCTTGTGAAACTGG + Intronic
1143262638 17:5611487-5611509 GTGTAGAAAGGTTCTGAAACAGG + Intronic
1143556776 17:7667001-7667023 GTGGAGGATGGTTGTCAAAAAGG + Intronic
1143684080 17:8499906-8499928 GTGTAGTAAGGTGGTCACATGGG + Intronic
1145849267 17:28075765-28075787 GGGTAGGAAGCTTATGAAGTGGG - Intronic
1148556286 17:48580749-48580771 GGCTAGGAAGGTGGGGAAATGGG - Intronic
1149856186 17:60085038-60085060 GTCTAGGTAGGTTGTGCACTTGG - Intergenic
1150378070 17:64698632-64698654 GTGGAGAAAGGGAGTGAAATAGG - Intergenic
1151052419 17:70993412-70993434 GTGGAGTAAGGTTTTGAATTTGG + Intergenic
1152763481 17:82122134-82122156 GTGTAGGAGGCTTGAGAAAGTGG - Intronic
1157334611 18:46728909-46728931 GTCTTGGAAGGTTCTGGAATAGG - Intronic
1157896993 18:51478776-51478798 GAGTAGGAAGGGTGTGGAGTGGG + Intergenic
1166394809 19:42431578-42431600 GTTAATGAAGGATGTGAAATAGG + Intronic
925746662 2:7049339-7049361 GTCCAGGAAGGAGGTGAAATTGG + Intronic
926950483 2:18237316-18237338 GTGTAGGAAGGTAGGTAAAGAGG + Intronic
927013361 2:18929651-18929673 GTGTAGGAATGCTGTCAAATAGG - Intergenic
927361008 2:22233661-22233683 CTGTATGAAAGATGTGAAATTGG - Intergenic
928468028 2:31541566-31541588 GTGTAGATAGTTTGTTAAATAGG - Intronic
928923676 2:36553958-36553980 GTGTGGGAAGGTGGGGAAGTCGG - Intronic
931554746 2:63490036-63490058 GTGTAGGATGATTGTAAATTTGG - Intronic
932952455 2:76310089-76310111 GTGTAGGAAGTATTGGAAATAGG + Intergenic
933425770 2:82110427-82110449 CTTTAGGAAGGTTGTGATAGAGG - Intergenic
933806387 2:86001033-86001055 GTGTGGGAAGTTCCTGAAATAGG - Intergenic
938721571 2:134071715-134071737 GAGGAGGAAGGGTGAGAAATGGG - Intergenic
939076011 2:137603429-137603451 TTGTAGGATGGTTTTGACATTGG + Intronic
939164216 2:138622601-138622623 GTGTAGGTGAGTTGTTAAATGGG + Intergenic
940269741 2:151876501-151876523 GTGAAAGAGGGCTGTGAAATTGG - Exonic
941437982 2:165495572-165495594 ACATATGAAGGTTGTGAAATAGG + Intronic
941493209 2:166168135-166168157 TTGAAGGAAGCTTATGAAATAGG + Intergenic
941792082 2:169563518-169563540 CTGTAGAAAGGTTTTGAAAGGGG + Intronic
942145205 2:173019859-173019881 GTCTAGGAAGCTTGTGTAAGGGG - Intronic
942180589 2:173376856-173376878 TTATAGGTAAGTTGTGAAATTGG + Intergenic
942185477 2:173421077-173421099 GTGCAGGAAGGCTGTGAGGTAGG - Intergenic
943405811 2:187482806-187482828 GTCTGGGGAGGGTGTGAAATAGG + Intronic
943463613 2:188200445-188200467 GTGAAGGAAGTTGGAGAAATGGG - Intergenic
944182879 2:196914697-196914719 GTGTATGGAAGTTGAGAAATTGG - Intronic
944480699 2:200154511-200154533 GTGTAGGAAGGGTCTGAGGTGGG - Intergenic
946330718 2:219007589-219007611 GTGTAGGAAGGTTGTGAAATTGG + Intronic
948786703 2:240356387-240356409 GTGTGGGAAGGGTGTGAAGAGGG + Intergenic
1168904337 20:1391796-1391818 GGGTGGGAAGGTTGAGAAAGGGG + Intronic
1170002508 20:11630709-11630731 TTGTGGGTAGGTTGTGAAATGGG + Intergenic
1170230311 20:14039314-14039336 ATCTTGGAAAGTTGTGAAATTGG + Intronic
1171491028 20:25517272-25517294 GTGTCAGGAGGGTGTGAAATGGG - Intronic
1171884203 20:30640016-30640038 GTATGAGAAGGTTGTGAGATTGG - Intergenic
1173273532 20:41558141-41558163 GGGTAGTAAGGTGGGGAAATGGG - Intronic
1175740479 20:61416641-61416663 TTGGAGGAAGCTTTTGAAATCGG + Intronic
1178250864 21:31002035-31002057 ATGTTGGAAGGTTGTGACATTGG + Intergenic
1178683695 21:34694862-34694884 ATGCAGGAAGTTTCTGAAATAGG + Intronic
1180747638 22:18101938-18101960 GAGTAGGAAGTTTGTGAAGCAGG + Exonic
1181780278 22:25187448-25187470 GTTTATGAAGATTGTTAAATGGG - Intronic
1182753894 22:32663144-32663166 GTGTAGCATGGTTGTGTAAGAGG + Intronic
1183741663 22:39672136-39672158 GTGGAGGAAGGTTGTGGAGCAGG + Intronic
955050182 3:55402862-55402884 TAGTAGGAAGGTTGTGGAGTGGG - Intergenic
955628763 3:60949393-60949415 TTGTACAAAGGTTGTCAAATGGG - Intronic
957154627 3:76532116-76532138 GAGGAGGAAGGTTGTGGAATAGG - Intronic
958071081 3:88612518-88612540 TTGTAGGAAGTTTTAGAAATGGG + Intergenic
958486114 3:94711734-94711756 GTTGAGGAAGGGTGTGAAACGGG - Intergenic
959769702 3:110078076-110078098 TTACAGGAAGGTTGTGAGATTGG - Intergenic
962748887 3:138418225-138418247 GTGTATGAAGCCTGTGAAAATGG - Intergenic
963815173 3:149822048-149822070 TTGTGGTAAGGTTTTGAAATTGG + Intronic
964042020 3:152271666-152271688 GTGGAGGAAAGAAGTGAAATAGG + Intronic
966288531 3:178326686-178326708 CTGAAGGAAGGGTGGGAAATAGG - Intergenic
967216448 3:187214635-187214657 GTATTGGAAGGTTGTGAAGATGG + Intergenic
971843358 4:31885180-31885202 GTTGAGGAACTTTGTGAAATAGG + Intergenic
972464271 4:39338604-39338626 GTGTAGGAAGTCTTTGAAATCGG + Intronic
972533236 4:39978287-39978309 GTCAAGGAAAGTTGTGCAATGGG + Intergenic
973116691 4:46469158-46469180 GTGTAGATAAGATGTGAAATAGG - Intronic
978633001 4:110768782-110768804 GTGTATGCAGGTTATGAGATAGG - Intergenic
979377357 4:119962735-119962757 GAGAAGGTAGGTTGTTAAATAGG + Intergenic
979654164 4:123172510-123172532 TTATAGGAAGATAGTGAAATTGG - Intronic
981179065 4:141717195-141717217 TTGTATGAAGGATGTGAATTTGG + Intronic
983459690 4:168012903-168012925 GAGTATTAAGATTGTGAAATAGG + Intergenic
986033843 5:3918644-3918666 GCTTAGGGAGGTTGTGAAAAGGG - Intergenic
987236471 5:15947167-15947189 TTATAGGAAGATTGGGAAATGGG - Intergenic
990141309 5:52707330-52707352 GTGTATGAAGGATGTGCTATTGG + Intergenic
991251611 5:64568408-64568430 GTGTAGGAAGGTGGAGGAAGAGG + Intronic
993256190 5:85592644-85592666 TTGTAAGAAGATTGTTAAATAGG + Intergenic
994607085 5:101981680-101981702 GTGTGAGAAGGCTGTGAAAAAGG + Intergenic
994738234 5:103584995-103585017 CTGCAGGATTGTTGTGAAATTGG - Intergenic
1003103352 6:3194447-3194469 GTGCAGCAAGCTTGTGAGATGGG + Intergenic
1003172698 6:3732839-3732861 GTGTAGGGAGGTGGTGCCATGGG - Intronic
1004658359 6:17686791-17686813 GGGTAGGAAGGTAGGGAAATAGG + Intronic
1004786743 6:18976309-18976331 TTGTAGGACAGTTGTGAAATTGG - Intergenic
1012638617 6:101580457-101580479 GAGTAGGAAGGTAGTGGAAGAGG - Intronic
1013164228 6:107575379-107575401 GAGTTGGAAGGTTCTGGAATTGG + Intronic
1016724429 6:147345967-147345989 GTGTAGGCAGGTTGTTAAGGTGG - Intronic
1017659761 6:156662231-156662253 GGGAAGGAAGTTTGTGAAACAGG - Intergenic
1020477270 7:8611590-8611612 GTGAAGGAAGGCACTGAAATAGG + Intronic
1021993940 7:26161768-26161790 GTGGAGGTAGGTTGGGGAATGGG + Intronic
1022792038 7:33699029-33699051 CTGCAGAAAGGATGTGAAATTGG - Intergenic
1023362198 7:39428753-39428775 GTGTAGGGAAGTGCTGAAATGGG - Intronic
1024777460 7:52804178-52804200 GTGGAGGAAAGGTGTTAAATAGG + Intergenic
1024780718 7:52845401-52845423 GTGTAGAAAGGTTAAGAAAGGGG - Intergenic
1027343859 7:77237677-77237699 GTGTAAGTAGCTTGTGATATGGG - Intronic
1028078354 7:86543309-86543331 GTGTAGTAAAGTCCTGAAATAGG - Intergenic
1030660593 7:112214692-112214714 GTGAAGGGAGGTTGGGAAAGAGG + Intronic
1031554247 7:123152147-123152169 GTATAGGAGAGTTCTGAAATAGG + Intronic
1032848876 7:135775386-135775408 GGTTAGGAAAGTTGTGACATAGG + Intergenic
1032917323 7:136506758-136506780 GTTTAGTAAGGTTTTGATATTGG + Intergenic
1035933613 8:3811700-3811722 TTGTAGGAAAATTGTGAAAGCGG + Intronic
1037409893 8:18585264-18585286 CTGTAGGAAGATTGTGAAAAGGG + Intronic
1037817973 8:22121648-22121670 TTGCAGGAAGGTTGTGGAGTTGG + Exonic
1038506231 8:28087425-28087447 GTGTAGGAGGTTTGTCAAACAGG - Intergenic
1039023121 8:33229089-33229111 ATGCAGGAAGGTTGAGAAAAAGG - Intergenic
1039132549 8:34283840-34283862 GTGGGGGGAGGTTGGGAAATAGG - Intergenic
1040930172 8:52725864-52725886 TTGTAGAAAAGTTTTGAAATTGG - Intronic
1044834595 8:96283281-96283303 GTGTAGGAAGGCTGTTCAAAAGG + Intronic
1045373875 8:101552170-101552192 GTGTAGGAAGGTGGACAAAGGGG + Intronic
1047455961 8:125011960-125011982 GGGAGGGAAGCTTGTGAAATGGG + Intronic
1054846183 9:69800989-69801011 TTGGAGGAAGGTTGTGGACTTGG + Intergenic
1057804620 9:98211402-98211424 GTGCAGGAGGGCTGTGAAGTGGG - Intronic
1058750435 9:108033921-108033943 GTGTAGGAGGATGGTGAAACAGG - Intergenic
1058987535 9:110222086-110222108 CTGTAGGAAGTTTGTGAACATGG + Intergenic
1059822711 9:117991887-117991909 GTGTAGGCAGGTGGTGCAAAAGG - Intergenic
1060857545 9:126926950-126926972 TAGGAGGAAGGTTGTGAATTTGG + Intronic
1186073388 X:5848623-5848645 GTGTAGGAGGCACGTGAAATGGG + Intronic
1187369964 X:18697032-18697054 CTCCAGGAAGCTTGTGAAATAGG + Intronic
1187543792 X:20227050-20227072 GAGTAGGAAGAATTTGAAATAGG - Intronic
1192348276 X:70331239-70331261 GTGTTGGAAGGGTCTGAGATAGG + Intronic
1193910327 X:87297810-87297832 GCATAGGAAGGTTGGGTAATTGG - Intergenic
1197173004 X:123455323-123455345 GTGAAGGAAGAAAGTGAAATTGG + Intronic
1197369150 X:125604617-125604639 GTGTGGGAAGGATGTGCAAAAGG - Intergenic
1198305754 X:135381384-135381406 GATAAAGAAGGTTGTGAAATTGG - Intergenic
1199742640 X:150750166-150750188 TTGTAGGAAGGTTCTTAACTAGG + Intronic
1199845821 X:151692597-151692619 GTGGAGGAAGGTAATGGAATTGG + Intergenic