ID: 946335444

View in Genome Browser
Species Human (GRCh38)
Location 2:219032439-219032461
Sequence TGCCACAGCGAGTGAGGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 210}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946335444_946335454 12 Left 946335444 2:219032439-219032461 CCCTGCCCTCACTCGCTGTGGCA 0: 1
1: 0
2: 0
3: 24
4: 210
Right 946335454 2:219032474-219032496 TCCAGAGGCCGGAAGACGATGGG 0: 1
1: 0
2: 0
3: 9
4: 105
946335444_946335453 11 Left 946335444 2:219032439-219032461 CCCTGCCCTCACTCGCTGTGGCA 0: 1
1: 0
2: 0
3: 24
4: 210
Right 946335453 2:219032473-219032495 CTCCAGAGGCCGGAAGACGATGG 0: 1
1: 0
2: 0
3: 17
4: 152
946335444_946335456 13 Left 946335444 2:219032439-219032461 CCCTGCCCTCACTCGCTGTGGCA 0: 1
1: 0
2: 0
3: 24
4: 210
Right 946335456 2:219032475-219032497 CCAGAGGCCGGAAGACGATGGGG 0: 1
1: 0
2: 0
3: 7
4: 166
946335444_946335449 1 Left 946335444 2:219032439-219032461 CCCTGCCCTCACTCGCTGTGGCA 0: 1
1: 0
2: 0
3: 24
4: 210
Right 946335449 2:219032463-219032485 ACCTTACCGCCTCCAGAGGCCGG 0: 1
1: 0
2: 0
3: 10
4: 77
946335444_946335448 -3 Left 946335444 2:219032439-219032461 CCCTGCCCTCACTCGCTGTGGCA 0: 1
1: 0
2: 0
3: 24
4: 210
Right 946335448 2:219032459-219032481 GCAGACCTTACCGCCTCCAGAGG 0: 1
1: 0
2: 0
3: 2
4: 50
946335444_946335459 23 Left 946335444 2:219032439-219032461 CCCTGCCCTCACTCGCTGTGGCA 0: 1
1: 0
2: 0
3: 24
4: 210
Right 946335459 2:219032485-219032507 GAAGACGATGGGGAGCGTGAGGG 0: 1
1: 0
2: 0
3: 15
4: 212
946335444_946335458 22 Left 946335444 2:219032439-219032461 CCCTGCCCTCACTCGCTGTGGCA 0: 1
1: 0
2: 0
3: 24
4: 210
Right 946335458 2:219032484-219032506 GGAAGACGATGGGGAGCGTGAGG 0: 1
1: 0
2: 0
3: 23
4: 304

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946335444 Original CRISPR TGCCACAGCGAGTGAGGGCA GGG (reversed) Intronic
900186466 1:1335480-1335502 TGCCACAGGGAGGGAGGTCTTGG - Exonic
901813381 1:11780031-11780053 GGGCACTGCGGGTGAGGGCAGGG + Intronic
901857584 1:12054196-12054218 TCCCACAGCCAGTCAGTGCAGGG - Intergenic
901944964 1:12694356-12694378 TGCCACATGGACTGGGGGCAAGG - Intergenic
903184005 1:21619314-21619336 TGCCGCTGGGAGTGGGGGCAGGG + Intronic
905387846 1:37616468-37616490 TGCATCAGTGAGTGTGGGCAGGG - Exonic
906217586 1:44052547-44052569 TTCCACAGAGAGTGAGGGTTAGG - Intergenic
906707539 1:47905741-47905763 TGCCATAGAGATTGAGGGCTGGG - Intronic
907293368 1:53433040-53433062 CTCCTCACCGAGTGAGGGCAAGG - Intergenic
909295276 1:73939558-73939580 TGACACAGGGAGTGAGGAAATGG - Intergenic
911890956 1:103371263-103371285 TGGCACACCCAGGGAGGGCATGG + Intergenic
913341160 1:117759229-117759251 TGCCAGAGCGAGTGTGGACGGGG - Intergenic
915102991 1:153514061-153514083 TGCCACAGGGACTGTGGGTAGGG - Intergenic
917539234 1:175897496-175897518 TGCCACTGGGGGTGAGGGTAAGG - Intergenic
918113898 1:181481673-181481695 TGCCCCAGCTAGTGTGGACATGG + Intronic
919937877 1:202266593-202266615 TGACGCAGGGAGTGAGGGCTTGG - Intronic
920254915 1:204648256-204648278 TCCCACAGTGAGAGAGGGCCTGG + Intronic
920720145 1:208379706-208379728 TGGCACACCCAGGGAGGGCATGG + Intergenic
923546593 1:234927852-234927874 TGCCACAGGGAGGGAGGGACTGG - Intergenic
924862287 1:247937071-247937093 AGCCCCAGCGAGTGAGCCCAGGG - Intergenic
1063274686 10:4552595-4552617 TGCCAGAGAGTGTGAGGGGAAGG + Intergenic
1067713697 10:48671238-48671260 TTCCCCAGTGACTGAGGGCAGGG + Intergenic
1069840964 10:71339179-71339201 TACCACAGCCAGTGAGGGCGAGG - Intronic
1069908682 10:71747023-71747045 TGCCACAGAGGGTGAGGGCCAGG - Intronic
1071988084 10:91072861-91072883 TGCCTCAGCGACTGAGGATAAGG - Intergenic
1072721035 10:97781291-97781313 GGCCACAGCTAGTGAGGGTGAGG + Intergenic
1073068599 10:100779346-100779368 TGCAGCAGTCAGTGAGGGCAGGG + Intronic
1076084420 10:127612775-127612797 GGCCACAGTGAGTGAGAGCAGGG - Intergenic
1076220133 10:128727276-128727298 TGCCGCAGCCACTGAGGACAGGG - Intergenic
1076723971 10:132404873-132404895 AGCCACAGCGGGTGAGGGAAGGG - Exonic
1077177976 11:1199198-1199220 TGCCACAAAGAGGAAGGGCAGGG + Intronic
1078467645 11:11561978-11562000 TCACACAGCGAGTGAATGCAGGG + Intronic
1079075099 11:17380326-17380348 TGCCACAGTGAGTGAGGGTGTGG + Intergenic
1081663919 11:44905406-44905428 TCCCACAGCTAGTAAGGGGAAGG - Intronic
1084403360 11:68957279-68957301 GGCCACAGTGATTGAGGGAAAGG - Intergenic
1085355451 11:75832527-75832549 TGGCACACCCAGAGAGGGCATGG - Intronic
1087117862 11:94544054-94544076 GGCCACAGTGAGCGAGGGCCAGG + Exonic
1089255697 11:117192783-117192805 GGACACAGGGACTGAGGGCAGGG - Intronic
1090289414 11:125528768-125528790 TGCCATACCCAGAGAGGGCATGG + Intergenic
1093254534 12:16850587-16850609 TGGCACACCAAGAGAGGGCATGG - Intergenic
1093687683 12:22075999-22076021 TGCCACAGTGGGTCGGGGCAGGG - Intronic
1095426084 12:42075998-42076020 TGACAAAGTGAGAGAGGGCAAGG + Intergenic
1096797572 12:54087486-54087508 TGCCAGAGCAAGGGAGGGGAGGG + Intergenic
1101395315 12:104342023-104342045 TGCCACACCTAGAGAGGACATGG - Intronic
1103854720 12:123958666-123958688 TGCCACAGTCAGTGACGCCAGGG - Intronic
1104228129 12:126857084-126857106 TTCCACAGTCAGTGAGAGCATGG + Intergenic
1104572871 12:129940699-129940721 TGCCACAGCGAGTGGTGGAGAGG + Intergenic
1104860777 12:131922314-131922336 TGCCACAGGGAGGGGCGGCAGGG - Exonic
1106044543 13:26126446-26126468 TGCCCCAGGGAGGCAGGGCAAGG + Intergenic
1107430778 13:40338370-40338392 TGACACAGGGAGTCAGGCCAAGG + Intergenic
1112187897 13:97145532-97145554 TGCCATATGAAGTGAGGGCATGG + Intergenic
1112799648 13:103096428-103096450 TGTGCCAGGGAGTGAGGGCAGGG - Intergenic
1113942636 13:114026359-114026381 TGCCAGAGCGAGGGAAGGCAGGG - Intronic
1114648920 14:24271053-24271075 TGCCACTGGGGGTGAGGGCGCGG + Intronic
1116164844 14:41322475-41322497 TGACACAACCAGGGAGGGCATGG + Intergenic
1119898740 14:78242646-78242668 TGCCCCAGCCAGGGAGGCCAGGG - Intronic
1121638807 14:95471803-95471825 TGTCGCAGCCAATGAGGGCAAGG + Intronic
1121699349 14:95940622-95940644 TGCAGCAGCAAGTCAGGGCAGGG - Intergenic
1121990866 14:98555994-98556016 TGTCACAGTGTTTGAGGGCAAGG - Intergenic
1122252448 14:100449458-100449480 TGCAACAGCCAGCCAGGGCAGGG - Intronic
1122314633 14:100818458-100818480 GGCCACAAGGAGGGAGGGCAAGG + Intergenic
1123008652 14:105336534-105336556 TGCAGGAGCGAGTGAGGACAGGG + Intronic
1126111200 15:45175670-45175692 TGCAACAGCCAGCGAGGGCTGGG + Intronic
1126545719 15:49871890-49871912 TGGGACTGGGAGTGAGGGCAGGG + Intronic
1128713986 15:69893662-69893684 TGGAACAGTGAGTGAGAGCATGG - Intergenic
1128987897 15:72234622-72234644 TGCCACTCCCAGGGAGGGCATGG + Intergenic
1129087315 15:73108798-73108820 TGCGACAGAGAGTGGGTGCAGGG + Intronic
1129360263 15:75019973-75019995 AGCCACAGCAACTGGGGGCATGG - Exonic
1132425065 15:101709266-101709288 TTCCATAGCCAGTGAGGGCAGGG - Intronic
1132497294 16:269885-269907 TGCCCCACAGAGTGAGGGCAGGG + Intronic
1134541857 16:15073574-15073596 TGCCACAGTGTGTGAGGTGAGGG - Intronic
1135137020 16:19892409-19892431 TGCCACTGAGAGTGAGGTCCTGG - Intergenic
1135524784 16:23205937-23205959 TCCCCCAGCCACTGAGGGCATGG - Intronic
1139481111 16:67231190-67231212 TGGCACAGCGGGTCAGGGCAGGG + Exonic
1140112878 16:72018588-72018610 GGCCACAGGGAGGGAGGGCTGGG - Intronic
1141724776 16:85780559-85780581 TGCCCCAGCCAGCGTGGGCACGG - Intronic
1141757526 16:86001919-86001941 AGACACAGCGAGTGAGGGGAAGG - Intergenic
1142102994 16:88285478-88285500 TGCCACAGCCAGCGTGGGCAGGG + Intergenic
1142266776 16:89067600-89067622 TAACACAGCCAGTGAGGACATGG + Intergenic
1142983374 17:3684101-3684123 AGACACAGGGACTGAGGGCAGGG - Intronic
1142995758 17:3759348-3759370 TGCCACAGAGACTCTGGGCATGG + Intronic
1144514818 17:15910009-15910031 CTACACAGCAAGTGAGGGCATGG + Intergenic
1144574051 17:16417870-16417892 TGAGACAGCAAGTGGGGGCAGGG + Intronic
1145127685 17:20315448-20315470 CTACACAGCGAGTGAGGGCGTGG + Intronic
1145263901 17:21370298-21370320 TGCCACAGTGAATGAGGAAAAGG + Intergenic
1146000455 17:29127585-29127607 TGCCATAGGGAGTCAGGGCCTGG - Intronic
1148997484 17:51723853-51723875 TGCCCCAGCTAATGAGTGCAAGG - Intronic
1149118451 17:53129916-53129938 TGACACAGCGAGAGATGGCATGG - Intergenic
1149358183 17:55866007-55866029 TTTCACAGGTAGTGAGGGCAGGG - Intergenic
1150917134 17:69448531-69448553 TGCAACTGGGAGTGAGGCCAAGG - Intronic
1152095524 17:78269668-78269690 TGTCCCAGCGACTGCGGGCAGGG - Intergenic
1152654634 17:81514059-81514081 GACAACAGCGAGTCAGGGCAAGG + Intronic
1153100183 18:1459242-1459264 TGCCACTGAGATTGAAGGCAGGG - Intergenic
1154197849 18:12279417-12279439 CCTCTCAGCGAGTGAGGGCAGGG - Intergenic
1154365847 18:13708300-13708322 TGGCACACCCAGAGAGGGCATGG - Intronic
1156333462 18:36147937-36147959 CGGCACAGCCAGGGAGGGCATGG - Intronic
1156540038 18:37900596-37900618 TGCCACACCGAGTGGAGGGAGGG + Intergenic
1156597022 18:38559217-38559239 GGACTCAGTGAGTGAGGGCAAGG + Intergenic
1158645602 18:59243040-59243062 TGCCACAGGGTGTGAGTGCGGGG + Intergenic
1159122412 18:64186051-64186073 TGCATCAGGGAGTGAGGGCAGGG - Intergenic
1161105302 19:2440878-2440900 TCCCACAGAGAGTGAGAGCTTGG - Intronic
1161717029 19:5882079-5882101 TGGCCCAGCGGGTGAGGGCCAGG - Intronic
1161746730 19:6064678-6064700 AGAGACAGCCAGTGAGGGCAGGG + Intronic
1163188480 19:15658333-15658355 TGCAGCAGCGAGAGACGGCAGGG - Exonic
1164401684 19:27906324-27906346 TGCCAAAGCGAGAGAGGGAGGGG + Intergenic
1164500943 19:28819688-28819710 TGCCAGTGCAGGTGAGGGCATGG + Intergenic
1164656460 19:29925418-29925440 TCCCCCAGTGAGTGAGTGCAGGG - Intronic
1165393322 19:35550561-35550583 TGCCACAGCAGGTGGGGGCAGGG - Exonic
1165408025 19:35642546-35642568 TGCCACAACGTGTGTGGGGAGGG + Intronic
1165850653 19:38848690-38848712 TGGCACAGCTAGTGAGGGGCAGG - Intronic
1167000630 19:46744327-46744349 AGCCACCACAAGTGAGGGCAGGG + Intronic
1167812582 19:51847549-51847571 TGCCACAGAGAGAGAGGCCTGGG - Intergenic
1168410393 19:56136269-56136291 TAGCACAGTGGGTGAGGGCAGGG - Intronic
925572859 2:5330364-5330386 TGCCACAGTGCGTGCGGGCATGG + Intergenic
927164010 2:20298949-20298971 TGGCACACCCAGGGAGGGCATGG + Intronic
927641433 2:24848031-24848053 AGCCACAGTGAGTGCAGGCAGGG - Intronic
928248437 2:29652795-29652817 TGTCACACCCAGAGAGGGCATGG + Intronic
929443685 2:41986316-41986338 TGCCAGAGCCCCTGAGGGCAAGG + Intergenic
929564775 2:42977469-42977491 TGCCACAGGGAGGAAGGGCTGGG + Intergenic
933553834 2:83807870-83807892 TGGCACACCCAGGGAGGGCATGG - Intergenic
933649672 2:84840480-84840502 TGTCACTGTGAGTGAGGGCCAGG - Intronic
935141761 2:100359438-100359460 TGGCACATCCAGAGAGGGCATGG - Intergenic
937098003 2:119248216-119248238 TGCCAGAGGGAGGAAGGGCATGG - Intronic
937523467 2:122739036-122739058 TGGCACATCTAGAGAGGGCATGG + Intergenic
937880430 2:126860267-126860289 TGCCACAGCCAGTGTGTGCCAGG - Intergenic
938607635 2:132912212-132912234 TGCCACAGAGAGCGAGAGCTTGG - Intronic
939867925 2:147495568-147495590 TGCCACAGCGAGGCCGGGCGTGG + Intergenic
940157732 2:150677052-150677074 TTCCACAGAGAGTCAGGGAAAGG + Intergenic
940750444 2:157621584-157621606 TTCCACAGCAAGTGTGGGAAGGG + Intronic
946335444 2:219032439-219032461 TGCCACAGCGAGTGAGGGCAGGG - Intronic
947970689 2:234321124-234321146 TGCCACAGCAAATGAGGTGATGG + Intergenic
1170941824 20:20854366-20854388 TGCCACAGGAAGTATGGGCAAGG + Intergenic
1171352902 20:24518386-24518408 TGCCACTGTGAGAAAGGGCATGG + Intronic
1171422920 20:25030850-25030872 TGCCACAGCCAATGGGGACACGG + Exonic
1171849412 20:30297340-30297362 TGCCAGAGCAAGGGAGGGGAGGG + Intergenic
1172011975 20:31850861-31850883 TGCCACAGAGGATGAGGACAAGG - Intronic
1172771706 20:37386018-37386040 GGCCACAGCCAGGGAAGGCATGG - Intronic
1173322563 20:42001453-42001475 AGGCACTGTGAGTGAGGGCATGG + Intergenic
1174286711 20:49479312-49479334 TGCAACAGAGAGTGAGGGGAGGG + Intronic
1175919945 20:62446133-62446155 GGCCACAGGTGGTGAGGGCAGGG + Intergenic
1175964989 20:62655935-62655957 TGACACAGCGAGCGGGGCCAGGG + Intronic
1176064460 20:63187482-63187504 GGCCACATCAAGTCAGGGCAGGG - Intergenic
1176164010 20:63663501-63663523 GGCCACAGCCTGTGAGGGCCGGG + Intronic
1176431444 21:6578761-6578783 TCCCACAGAGAGCGTGGGCAAGG + Intergenic
1179279898 21:39925270-39925292 TGCTGCAGGGAGTGAGGACAAGG + Intronic
1179626621 21:42653015-42653037 TGCTACAGGGAGTGTGGGAAAGG - Intergenic
1179706838 21:43186223-43186245 TCCCACAGAGAGCGTGGGCAAGG + Intergenic
1180065439 21:45409918-45409940 GGCCACAGAGAGTGAGGGAGCGG + Intronic
1180226827 21:46398527-46398549 TGTCACAGCCAGTATGGGCAGGG + Intronic
1181547006 22:23607820-23607842 TGACACAGAAAGTGATGGCAAGG - Intergenic
1181997732 22:26896053-26896075 TGCCCCAAGGAGTGAGGTCAAGG - Intergenic
1182149093 22:28016171-28016193 TTCCAGAGTGAGTGAGGCCAGGG - Intronic
1183075758 22:35425907-35425929 TGTCACAGTGAGGGAGTGCAGGG + Intergenic
1184090504 22:42290646-42290668 AGCCACAGCGAGTGGGCTCAGGG - Intronic
1184461245 22:44639457-44639479 TGCCACATGGAAGGAGGGCAAGG + Intergenic
949768891 3:7556631-7556653 TGCCACGTTCAGTGAGGGCAGGG - Intronic
950190121 3:10970800-10970822 TGCCAAGGGGAGTGAGGGAAAGG - Intergenic
950390595 3:12693636-12693658 TCACACAGCTAGTGAGGGCTAGG + Intergenic
953295763 3:41714342-41714364 TGCCACAACAAGTGAGGATATGG - Intronic
954442968 3:50531708-50531730 TCCCACAGCGGTTAAGGGCAGGG - Intergenic
963674241 3:148288307-148288329 TGGCACAGGCAGGGAGGGCATGG - Intergenic
966882535 3:184358404-184358426 TACCACACAGAGTCAGGGCATGG + Intronic
968446766 4:656038-656060 CGCCGCACCCAGTGAGGGCAAGG - Intronic
968573457 4:1354271-1354293 TGCCACAGCGGGGGAAGCCACGG + Intronic
970628874 4:17919972-17919994 TGGCACACCCAGGGAGGGCATGG + Intronic
973808347 4:54546815-54546837 TGCCACAGCAAGTCAGGGTAGGG - Intergenic
980301032 4:130994958-130994980 TGCCACAGAGAGTGAACTCAAGG + Intergenic
980765770 4:137301745-137301767 TGGCACACCCAGGGAGGGCATGG - Intergenic
981434082 4:144699383-144699405 TGGCACACCCAGAGAGGGCAGGG - Intronic
982068141 4:151672683-151672705 TGCCACAGGGAGCGATGGCGAGG + Intronic
984983016 4:185301293-185301315 TGACACACCCAGGGAGGGCATGG + Intronic
986928909 5:12794658-12794680 TGCCACAGCGTTGGAGGGCAGGG + Intergenic
988480559 5:31626964-31626986 TGCCACATCTAGCGAGGGCAGGG + Intergenic
990473689 5:56141624-56141646 TGGCACACCCAGAGAGGGCACGG + Intronic
991017230 5:61945239-61945261 TGGGAGAGAGAGTGAGGGCATGG - Intergenic
993704508 5:91154532-91154554 TGCCACAGCGGCTGAGAGCACGG - Intronic
994017913 5:94989894-94989916 TGTCACAGCCAGAGAGGGCATGG + Intronic
994575554 5:101574616-101574638 TGACAAAGATAGTGAGGGCAAGG + Intergenic
997368647 5:133342007-133342029 TGCCAGAGCCAGTGAGGAGATGG - Intronic
999843235 5:155451202-155451224 TGCCACTGGGGGAGAGGGCATGG - Intergenic
1001284642 5:170413709-170413731 TGCCACATGGAATGAGGGCAGGG + Intronic
1002259933 5:177985843-177985865 GGGCACGGCGAGTGTGGGCAGGG + Intergenic
1002259951 5:177985916-177985938 GGGCACGGCGAGTGTGGGCACGG + Intergenic
1002259954 5:177985931-177985953 GGGCACGGCGAGTGTGGGCACGG + Intergenic
1002259958 5:177985946-177985968 GGGCACGGCGAGTGTGGGCAGGG + Intergenic
1002861950 6:1087187-1087209 TGCCACAGCAAGTGTGGACAAGG - Intergenic
1003489712 6:6610658-6610680 GGCCAAAGCGAGGGAGGGCTGGG + Intronic
1005379023 6:25215254-25215276 TGCCCAAGCTAGTCAGGGCATGG + Intergenic
1007484870 6:42174067-42174089 TGCCCTAGAAAGTGAGGGCAGGG - Intronic
1010764675 6:79765360-79765382 TGCAAGAGCAAGTGACGGCAGGG + Intergenic
1010832412 6:80547082-80547104 TGCCTCAGTGAGGGAGGTCATGG + Intergenic
1016017903 6:139204932-139204954 TGCCACAGCCACTGTGGGGATGG - Intergenic
1019132223 6:169885370-169885392 GGCAACAGTGAGAGAGGGCAGGG + Intergenic
1019913591 7:4116441-4116463 TGCCACAGCGTGGAAGGGCCTGG + Intronic
1023027756 7:36066241-36066263 TGCTATAGTGAGTGAGGGGAGGG - Intergenic
1026152125 7:67796760-67796782 AGCCACAGAGAGTGAGGGAAGGG - Intergenic
1026735249 7:72945126-72945148 AGCCAGAGCCAGTCAGGGCAAGG + Intronic
1026740301 7:72975010-72975032 AGACGCAGCCAGTGAGGGCAGGG - Intergenic
1026785591 7:73300055-73300077 AGCCAGAGCCAGTCAGGGCAAGG + Intergenic
1026797608 7:73376519-73376541 AGACGCAGCCAGTGAGGGCAGGG - Intergenic
1027103430 7:75390060-75390082 AGACGCAGCCAGTGAGGGCAGGG + Intergenic
1027108476 7:75419881-75419903 AGCCAGAGCCAGTCAGGGCAAGG - Intronic
1027532441 7:79353366-79353388 TGCCACAGCCAGAGACAGCAAGG - Intronic
1029438563 7:100575379-100575401 GGCCCCAGCACGTGAGGGCAGGG - Intronic
1032390056 7:131549975-131549997 TGCTCCAGCGATTCAGGGCAGGG + Intronic
1034528971 7:151683739-151683761 TGCCACAGCCAGAGAGGGACAGG + Intronic
1038975062 8:32686452-32686474 TGCCACAATGAGTGAAGTCAGGG + Intronic
1039723694 8:40192192-40192214 TGCCACTTCGAGTTAGGCCAAGG - Intergenic
1041919877 8:63169095-63169117 TGCCGCGGCGGGTGGGGGCAAGG + Intronic
1044783956 8:95775100-95775122 GGCCTCAGGGATTGAGGGCAAGG - Intergenic
1047873784 8:129113138-129113160 TGCCACAACCAGTGAGTGCCCGG + Intergenic
1048731354 8:137444349-137444371 TGCCACATCTGGTGAAGGCATGG - Intergenic
1048999411 8:139815232-139815254 TGCCACAGGGAAGGCGGGCAGGG - Intronic
1049323322 8:142009095-142009117 TGCCAACGCGAGTGATGGGATGG + Intergenic
1050755257 9:8994691-8994713 TGACACAGTGAGGGAAGGCAAGG + Intronic
1051995255 9:23208188-23208210 TGCAAAAGCTATTGAGGGCAGGG - Intergenic
1053787200 9:41660634-41660656 TGCCAGAGCAAGAGAGGGGAGGG + Intergenic
1054157927 9:61654133-61654155 TGCCAGAGCAAGGGAGGGGAGGG - Intergenic
1054175477 9:61871973-61871995 TGCCAGAGCAAGAGAGGGGAGGG + Intergenic
1054477700 9:65585138-65585160 TGCCAGAGCAAGGGAGGGGAGGG - Intergenic
1054662060 9:67708837-67708859 TGCCAGAGCAAGAGAGGGGAGGG - Intergenic
1056457570 9:86775868-86775890 TGCCACATCAAATGTGGGCAAGG - Intergenic
1056601530 9:88050765-88050787 TGCCACAGCGAGGAGGGGAATGG - Intergenic
1057804287 9:98209521-98209543 TACCACAGCCAGTAAGCGCAGGG + Intronic
1059244055 9:112834520-112834542 TGCTACACCCAGGGAGGGCATGG - Intronic
1059721006 9:116960076-116960098 CGTCACAGCCAGGGAGGGCAGGG + Intronic
1062622754 9:137430036-137430058 TGCCACAGCTAGCGAGGTCCCGG + Intronic
1190337896 X:49273794-49273816 AGCCACATCAGGTGAGGGCATGG + Intronic
1192729176 X:73785474-73785496 TGGCACACCCAGGGAGGGCATGG - Intergenic
1194678332 X:96820034-96820056 TGCCACAGCAAATAAGGCCATGG - Intronic
1195349628 X:103984340-103984362 TGCAAGAGTGATTGAGGGCACGG + Intergenic
1195357815 X:104054499-104054521 TGCAAGAGTGATTGAGGGCACGG - Intergenic
1196028028 X:111063202-111063224 TCACACAGCAAGTGAGGGAAGGG - Intronic
1197401321 X:125994883-125994905 TGCAAGAGAGAGTGAGGGAAGGG + Intergenic
1202061834 Y:20896970-20896992 CTCCTCAGCGAATGAGGGCAAGG - Intergenic