ID: 946336216

View in Genome Browser
Species Human (GRCh38)
Location 2:219038405-219038427
Sequence GGCTGCACTGCTGTCGTTGA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 124}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946336208_946336216 25 Left 946336208 2:219038357-219038379 CCCTGGCTGTATCCTTACCTGGG 0: 1
1: 0
2: 0
3: 16
4: 176
Right 946336216 2:219038405-219038427 GGCTGCACTGCTGTCGTTGATGG 0: 1
1: 0
2: 0
3: 11
4: 124
946336206_946336216 29 Left 946336206 2:219038353-219038375 CCTGCCCTGGCTGTATCCTTACC 0: 1
1: 0
2: 2
3: 34
4: 274
Right 946336216 2:219038405-219038427 GGCTGCACTGCTGTCGTTGATGG 0: 1
1: 0
2: 0
3: 11
4: 124
946336213_946336216 8 Left 946336213 2:219038374-219038396 CCTGGGCGCTGATGGTGCTGCAG 0: 1
1: 0
2: 1
3: 23
4: 245
Right 946336216 2:219038405-219038427 GGCTGCACTGCTGTCGTTGATGG 0: 1
1: 0
2: 0
3: 11
4: 124
946336210_946336216 24 Left 946336210 2:219038358-219038380 CCTGGCTGTATCCTTACCTGGGC 0: 1
1: 0
2: 0
3: 18
4: 144
Right 946336216 2:219038405-219038427 GGCTGCACTGCTGTCGTTGATGG 0: 1
1: 0
2: 0
3: 11
4: 124
946336212_946336216 13 Left 946336212 2:219038369-219038391 CCTTACCTGGGCGCTGATGGTGC 0: 1
1: 0
2: 0
3: 6
4: 112
Right 946336216 2:219038405-219038427 GGCTGCACTGCTGTCGTTGATGG 0: 1
1: 0
2: 0
3: 11
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946336216 Original CRISPR GGCTGCACTGCTGTCGTTGA TGG Exonic
900402156 1:2476990-2477012 GGCTCCAATGCTCTCATTGAAGG + Intronic
900484198 1:2913806-2913828 GGCAGCACTGCTTTCTTTGATGG - Intergenic
900540083 1:3198198-3198220 GGCTGGGTTGCTGTGGTTGAAGG + Intronic
906781312 1:48575487-48575509 GGCAGCACTGGTGTGGTTGTGGG + Intronic
910588274 1:88902184-88902206 GGCTTCACCGCTGTCCTTTAGGG - Intergenic
910831035 1:91462961-91462983 GGCTTCACTGCTGTCCTTCAGGG + Intergenic
910903656 1:92150078-92150100 GTCTGCACCGATGTCATTGATGG + Intergenic
912593492 1:110851025-110851047 GGCTTCTCTGCTGCCCTTGAAGG + Intergenic
913389867 1:118298544-118298566 GGCGGCTCTGCTGACCTTGAGGG + Intergenic
918075291 1:181166337-181166359 GGCTGCAATGCTGACGTTGGAGG + Intergenic
923625898 1:235613555-235613577 TGCTACACTGCTGGCTTTGAAGG + Intronic
923626104 1:235615266-235615288 CGCTACACTGCTGGCTTTGAAGG + Intronic
924225645 1:241919584-241919606 GGATGAACTCCTATCGTTGATGG + Intergenic
1065928674 10:30459124-30459146 GGCTGAACTGCATTCGTTGCAGG + Intronic
1067806733 10:49397905-49397927 GGCTGGGCTGCTGCCGCTGAGGG - Intergenic
1071299965 10:84248987-84249009 GGCTGCACTGCTGCAGATGCTGG - Exonic
1071470341 10:85979759-85979781 TGCAGCACTGCTGTCCTTGGTGG + Intronic
1071798343 10:89029916-89029938 GGTTGCACTGCTTTCAGTGATGG - Intergenic
1075982046 10:126748431-126748453 GCCTGGACTTCTGTCGTGGATGG + Intergenic
1077584895 11:3443755-3443777 GGCAGCATTACTGTCATTGAAGG + Intergenic
1078326682 11:10387111-10387133 GGCTTCAGGGATGTCGTTGAGGG - Intronic
1080672009 11:34388876-34388898 GGCCGAACTGCTATAGTTGAAGG + Intergenic
1081615345 11:44587535-44587557 AGCTGCACTGGTTTCGTGGAAGG + Exonic
1084830549 11:71765531-71765553 GGCAGCATTACTGTCATTGAAGG - Intergenic
1085154059 11:74277084-74277106 GGCAGCAATGCGGTGGTTGAGGG + Exonic
1087786531 11:102361118-102361140 GGCAGCACTGATGTCTCTGATGG + Intronic
1092333688 12:7608801-7608823 TGCTGCACTGCTGTTGTTGCTGG + Intergenic
1092412045 12:8261032-8261054 GGCAGCATTACTGTCATTGAAGG + Intergenic
1095393896 12:41741414-41741436 GGCTGCAGTGCTGGCTTTGAAGG - Intergenic
1102042222 12:109808352-109808374 GGCTCCACTGCTGACCTGGACGG - Exonic
1102787094 12:115613852-115613874 TGCTGCGCTGCTGGCCTTGAAGG + Intergenic
1105592095 13:21801833-21801855 AGCTGCACTACTTTAGTTGAAGG + Intergenic
1111610664 13:90603094-90603116 TGTTGCACAGCTGTAGTTGAAGG - Intergenic
1124155557 15:27222277-27222299 GGGTGCACTGCTGCCTTAGATGG - Intronic
1126495896 15:49290297-49290319 GGCTGTGCAGCTGTCATTGAGGG + Intronic
1127142705 15:55993675-55993697 GGAGGCGCTGCTGTCGCTGAGGG - Intronic
1130786658 15:87104731-87104753 GTCTGCACTGGTGTTGGTGATGG - Intergenic
1133353290 16:5117233-5117255 GGCAGCATTACTGTCATTGAAGG + Intergenic
1133809325 16:9149067-9149089 GGCAGCACTGCTCGCCTTGAAGG - Intergenic
1134683334 16:16141778-16141800 GGCTGCAGTTTTGTGGTTGAGGG + Exonic
1136288648 16:29258723-29258745 GGCTGCGCTGCTGGCCTGGAAGG - Intergenic
1141034548 16:80616097-80616119 GGCTGCACTGATGTGGCAGAAGG + Intronic
1141769412 16:86080309-86080331 GGCTGCACTGCTGACTTTGCAGG + Intergenic
1142094363 16:88231629-88231651 GGCTGCGCTGCTGGCCTGGAAGG - Intergenic
1143038988 17:4018513-4018535 GACTCCACTGCTGTGGTTGGAGG + Intronic
1147692259 17:42323509-42323531 ACCTGCACGGCTGTCGTTGAGGG - Intronic
1153621542 18:6983186-6983208 GGCTGCACTGGTGGCATTCAGGG + Exonic
1154170744 18:12048328-12048350 GGCTGCACTGCCTTCATTGGAGG - Intergenic
1158544585 18:58385418-58385440 CTCTGCTCTGCTGTCGTGGATGG + Intronic
1158917337 18:62147565-62147587 TGATGCACTGCTGTAATTGATGG - Intronic
1159752405 18:72319007-72319029 GGCTGCCCTGGTTTTGTTGATGG - Intergenic
1160682158 19:416872-416894 GGGTGCACAGTTGTCTTTGAGGG - Exonic
1162050698 19:8030836-8030858 GGCTGCGCTGCTGGCCGTGAAGG + Intronic
1164179121 19:22804709-22804731 GGCTGGAATTCTGTGGTTGATGG + Intergenic
1165575822 19:36816324-36816346 CACTGCACTGCAGTCGGTGATGG - Intergenic
1168695071 19:58399656-58399678 TGCTGCACTGCTGGCTTTGAAGG - Intergenic
927807757 2:26162926-26162948 GCCTACACTGCAGTCTTTGATGG + Intergenic
929787038 2:45000710-45000732 TGCTGCACTGCGGTCTTTGGAGG + Intergenic
930370069 2:50490708-50490730 GGCTGCACTGCTGTCACGGTGGG + Intronic
931462253 2:62459204-62459226 GGCAGCATTTCTGTAGTTGAGGG + Intergenic
935492354 2:103735830-103735852 GGCTTCACTGCTGTAGATAAGGG + Intergenic
937015538 2:118602088-118602110 TGCTGCACTGCTGTCTGTGAGGG + Intergenic
944646038 2:201781757-201781779 GACTACACATCTGTCGTTGATGG - Intergenic
945702493 2:213189440-213189462 GACTCTACTGCTGTCATTGAGGG - Intergenic
946336216 2:219038405-219038427 GGCTGCACTGCTGTCGTTGATGG + Exonic
946433173 2:219636198-219636220 GGCTGCTCTGCTTTTGTTGGGGG + Intronic
947880725 2:233508977-233508999 GGCTTCACTGCTTTCTGTGATGG + Intronic
948652647 2:239458034-239458056 GGCTTCACAGCTGCAGTTGATGG + Intergenic
1170548295 20:17453857-17453879 GGCAGTCCTGCCGTCGTTGATGG - Exonic
1172099923 20:32479199-32479221 CTCTGCACAGTTGTCGTTGACGG - Intronic
1174094927 20:48080781-48080803 GGGTGTACTGCTGTAGTTGGGGG - Intergenic
1177166486 21:17611095-17611117 GGCTGCACAGCAGTCGTGGTGGG - Intronic
1178626209 21:34220967-34220989 GACTTCACTGCTGAGGTTGAGGG - Intergenic
1185203664 22:49523885-49523907 GGCTGCGCTGCTGCCGGTGCTGG - Intronic
949598108 3:5568896-5568918 TCCTGCACTTCTGTCATTGACGG - Intergenic
954345881 3:49998940-49998962 GTCAGCACTTCTGTCTTTGAAGG + Intronic
956306933 3:67836063-67836085 GCCTTCACTGCTGTCCTTCAGGG - Intergenic
956340698 3:68220792-68220814 TGCTGCACTGCTGTCTCTAAGGG + Intronic
956557393 3:70538856-70538878 GGCTGAACTGCTGTCTTCTAAGG - Intergenic
957467871 3:80619092-80619114 GGCTGTTCTGCTGTCCTGGATGG - Intergenic
961889600 3:130119680-130119702 GGCAGCATTACTGTCATTGAAGG + Intergenic
962463011 3:135631871-135631893 GGCTGCACTGCTGGCCTGAAGGG + Intergenic
962862755 3:139419581-139419603 TGCTGCACTGCTGCGGATGAGGG + Intergenic
964345081 3:155746853-155746875 GGGTGAACTGCTGCTGTTGAGGG - Intergenic
964965118 3:162482361-162482383 AGCTGCACTGCTGGGGTTGTAGG + Intergenic
966869006 3:184277934-184277956 AGCTTCACTGCTGGAGTTGAAGG - Exonic
969000090 4:3973598-3973620 GGCAGCATTACTGTCATTGAAGG + Intergenic
969753931 4:9135009-9135031 GGCAGCATTACTGTCATTGAAGG - Intergenic
969813821 4:9671205-9671227 GGCAGCATTACTGTCATTGAAGG - Intergenic
972586191 4:40438776-40438798 GGCAGCACTGCTGGCGCTGATGG - Exonic
981454061 4:144933445-144933467 GGCTGCACTTCTGCTGCTGATGG + Intergenic
986041837 5:4001226-4001248 GGCTGCACTGCAGTAATAGATGG - Intergenic
986882200 5:12187849-12187871 TGCTGTACTGCTGGCTTTGAAGG - Intergenic
987861323 5:23491871-23491893 TGCTGCACTGCTGTGGCTGCTGG - Intergenic
997257420 5:132439755-132439777 GTCAGCACTGCTGTCTTTGCAGG + Intronic
998554839 5:143113415-143113437 GGCTGTACTGCTTTCATTCAAGG - Intronic
1002315121 5:178338492-178338514 TGCTGCGCTGCTGTCATTAAAGG - Intronic
1007272084 6:40645570-40645592 GGCTGCATTGCTCTGATTGACGG + Intergenic
1008237329 6:49065931-49065953 GGCTGCTCTTCTGACCTTGATGG - Intergenic
1008772127 6:54991966-54991988 GCCTCCACTGCTCTCATTGATGG + Intergenic
1013437773 6:110129276-110129298 TGCTGCACTTCTGTCTTTGTTGG - Intronic
1013721775 6:113039103-113039125 GGCTTCACTTCTGTTTTTGAAGG - Intergenic
1014103175 6:117533984-117534006 GCATGCACTGCTGTCCTTGGTGG - Intronic
1017076441 6:150623207-150623229 GGCTGCACCTGTGTGGTTGAAGG - Intronic
1018928741 6:168225628-168225650 GGCCCCACTTCTGTTGTTGAAGG + Intergenic
1020710411 7:11598060-11598082 CCCTTCACTGCTGTCCTTGAGGG - Intronic
1021123670 7:16825963-16825985 AGCTGCACTGCTGGGGTTGGGGG - Intronic
1022215678 7:28258576-28258598 GGCTGGAATGCTGACATTGAGGG + Intergenic
1028985609 7:97006366-97006388 GGCTGCGCTGCTGTTGTGGTAGG - Exonic
1035782529 8:2239727-2239749 GCCTGCACTGCCGTTGTTGGTGG - Intergenic
1035809591 8:2479861-2479883 GCCTGCACTGCCGTTGTTGGTGG + Intergenic
1036377147 8:8210358-8210380 GGCAGCATTACTGTCATTGAAGG - Intergenic
1036852401 8:12212791-12212813 GGCAGCATTACTGTCATTGAAGG + Intergenic
1036873769 8:12455314-12455336 GGCAGCATTACTGTCATTGAAGG + Intergenic
1037506443 8:19534523-19534545 GGCTGCATTGCTGTAGATGGTGG + Intronic
1038036708 8:23692310-23692332 GGCTTAACTGCTGGCTTTGAAGG - Intergenic
1040912000 8:52528852-52528874 GCCTTCACTGCTGTCCTTCAGGG - Intergenic
1045216900 8:100158046-100158068 GGCTGCACTGCAGGTGCTGAGGG - Intronic
1047778270 8:128091338-128091360 GCCTGCACTGCTATGGGTGAGGG + Intergenic
1055889819 9:81111489-81111511 CGCTACACTGCTGACTTTGAAGG - Intergenic
1056534646 9:87516962-87516984 GGCTGCACTGGAGTCATAGAGGG + Intronic
1056654399 9:88497232-88497254 GGTTCCACTGCTGTCATTCAAGG + Intergenic
1057383263 9:94587537-94587559 GACTGCACTGCTGGCGTTTTAGG - Intronic
1058535210 9:105951269-105951291 GTGTGCACTGCTGTCATGGAGGG - Intergenic
1058828872 9:108797768-108797790 GGCAGGACTGCTGTCCTTTAAGG + Intergenic
1058933735 9:109748289-109748311 GGCTGCCCTTCTGCAGTTGAGGG + Intronic
1061782551 9:133004465-133004487 GGCTGCACTGCTGCAGGTGTGGG + Intergenic
1061819821 9:133220900-133220922 GGCTGTGCTGCTGGCTTTGAAGG + Intergenic
1062240834 9:135537048-135537070 GGCTGTGCTGCTGGCTTTGAAGG - Intergenic
1062708252 9:137957120-137957142 GGCCCCACTGCTGTGGTTGCTGG + Intronic
1192634457 X:72804488-72804510 GGCTGCATTGCTGTAATGGAAGG + Intronic
1194678960 X:96828208-96828230 GGCTTCACTGCTGTCCTTACTGG - Intronic
1194986331 X:100493594-100493616 GTCTGGACTGCTGCCGTTGATGG - Intergenic
1195273102 X:103252639-103252661 TGATGCACTGCAGTCCTTGAGGG - Intergenic
1197863608 X:130995765-130995787 GGCTGCCCAGCTGTCTTTCAGGG - Intergenic
1198083486 X:133261717-133261739 TGCTGCCCTGCTGGCTTTGAAGG + Intergenic