ID: 946336592

View in Genome Browser
Species Human (GRCh38)
Location 2:219041533-219041555
Sequence ACGGCGTCTTCAGATATCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 31
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 28}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946336588_946336592 7 Left 946336588 2:219041503-219041525 CCGTCTCCATAGATACAGGACGC 0: 1
1: 0
2: 0
3: 4
4: 60
Right 946336592 2:219041533-219041555 ACGGCGTCTTCAGATATCCCAGG 0: 1
1: 0
2: 0
3: 2
4: 28
946336590_946336592 1 Left 946336590 2:219041509-219041531 CCATAGATACAGGACGCGCAGGA 0: 1
1: 0
2: 0
3: 4
4: 40
Right 946336592 2:219041533-219041555 ACGGCGTCTTCAGATATCCCAGG 0: 1
1: 0
2: 0
3: 2
4: 28
946336586_946336592 15 Left 946336586 2:219041495-219041517 CCATATTGCCGTCTCCATAGATA 0: 1
1: 0
2: 0
3: 11
4: 100
Right 946336592 2:219041533-219041555 ACGGCGTCTTCAGATATCCCAGG 0: 1
1: 0
2: 0
3: 2
4: 28
946336585_946336592 18 Left 946336585 2:219041492-219041514 CCTCCATATTGCCGTCTCCATAG 0: 1
1: 0
2: 0
3: 6
4: 80
Right 946336592 2:219041533-219041555 ACGGCGTCTTCAGATATCCCAGG 0: 1
1: 0
2: 0
3: 2
4: 28

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946336592 Original CRISPR ACGGCGTCTTCAGATATCCC AGG Intergenic
902991497 1:20190702-20190724 ACCGAGTCTGCAGAAATCCCAGG + Exonic
1088540837 11:110911852-110911874 TCTACTTCTTCAGATATCCCTGG - Intergenic
1103226438 12:119291858-119291880 AAGCCCTCTTCAGCTATCCCTGG - Intergenic
1113639597 13:111947655-111947677 GCGGCATCTTCAGAGAACCCAGG + Intergenic
1125346264 15:38722020-38722042 ACGGCGCATTCTGATATCCCAGG + Intergenic
1133280787 16:4664036-4664058 ACCGCGTTTTCAGTTCTCCCGGG - Intronic
1139602222 16:67993641-67993663 ACGTGGTCTGCAGATCTCCCAGG - Exonic
1140211555 16:72974626-72974648 GCGAGTTCTTCAGATATCCCTGG + Intronic
1142928246 17:3259852-3259874 ATGGTGTCTTCAGATAAACCTGG - Intergenic
1158041113 18:53095327-53095349 ACTGCTTCTTCTGATATCCATGG - Intronic
1164696265 19:30246863-30246885 ATAGTGTCTTCAAATATCCCTGG - Intronic
1165393515 19:35551437-35551459 AAGGCTTCTTCAGGTGTCCCTGG - Exonic
925181014 2:1816935-1816957 ACGGCGTCTGCAGGGACCCCTGG - Intronic
946336592 2:219041533-219041555 ACGGCGTCTTCAGATATCCCAGG + Intergenic
946755440 2:222940975-222940997 ACTGCATCTTCAGATCTCCTGGG + Intronic
1171256017 20:23689409-23689431 CCGGGGTCTTCAGATATCAGAGG + Intergenic
1171272416 20:23827098-23827120 CCGGGGTCTTCAGATATCAGAGG + Intergenic
1177692382 21:24527760-24527782 ATGGCTTCTTCAGAAATCCTAGG + Intergenic
1179587161 21:42380716-42380738 TCGTCGCCTCCAGATATCCCAGG - Intronic
1180748224 22:18106831-18106853 ACTACGTCTTCAGCTCTCCCGGG - Intronic
962318035 3:134370932-134370954 ACGGCTCCTTCAGTTGTCCCTGG - Exonic
972075574 4:35081721-35081743 ACTCAGTCTTCAGATTTCCCAGG + Intergenic
995210407 5:109531115-109531137 ATGTTGTCTTCAGAGATCCCTGG + Intergenic
997725727 5:136118413-136118435 AGAGCATCTTCAGATATCCACGG - Intergenic
1003727203 6:8778497-8778519 ACAGTGTCTTCAGATATTACAGG - Intergenic
1017015339 6:150095219-150095241 ACAGAGTCTTGACATATCCCTGG + Intergenic
1023492497 7:40758926-40758948 ACGGCTTCTTGAAATAACCCAGG - Intronic
1033896791 7:146081495-146081517 ACAGTGTCTTCACATATCCCTGG + Intergenic
1035709219 8:1699742-1699764 ACGGCGTCTTAAAAATTCCCTGG + Intronic
1053893126 9:42716205-42716227 GCAGCCTCTTCTGATATCCCTGG - Intergenic
1188548173 X:31333476-31333498 ACTGCATCTTCAGTTATTCCTGG - Intronic