ID: 946337201

View in Genome Browser
Species Human (GRCh38)
Location 2:219045827-219045849
Sequence AAGAGCGTCCAGGGCAATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946337190_946337201 30 Left 946337190 2:219045774-219045796 CCACATTGTGCCAGGGTCATAAG No data
Right 946337201 2:219045827-219045849 AAGAGCGTCCAGGGCAATGAAGG No data
946337192_946337201 20 Left 946337192 2:219045784-219045806 CCAGGGTCATAAGGAAGCATGAG No data
Right 946337201 2:219045827-219045849 AAGAGCGTCCAGGGCAATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946337201 Original CRISPR AAGAGCGTCCAGGGCAATGA AGG Intergenic
No off target data available for this crispr