ID: 946337301

View in Genome Browser
Species Human (GRCh38)
Location 2:219046617-219046639
Sequence GCTGACTTCCACACTGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946337301_946337305 -7 Left 946337301 2:219046617-219046639 CCTTCCTCAGTGTGGAAGTCAGC No data
Right 946337305 2:219046633-219046655 AGTCAGCCTGGACTCAGGTATGG No data
946337301_946337307 16 Left 946337301 2:219046617-219046639 CCTTCCTCAGTGTGGAAGTCAGC No data
Right 946337307 2:219046656-219046678 CAAGAGAGCCCACCTTTGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946337301 Original CRISPR GCTGACTTCCACACTGAGGA AGG (reversed) Intergenic
No off target data available for this crispr